EMAIL THIS PAGE TO A FRIEND

DVL1

dishevelled segment polarity protein 1

79 Gene Product Result for
Synonyms: DVL DVL1L1 DVL1P1
UniProtKB ID: O14640, Q5TA33, Q5TA35
Gene ID:
Human(1855) Summary: DVL1, the human homolog of the Drosophila dishevelled gene (dsh) encodes a cytoplasmic phosphoprotein that regulates cell proliferation, acting as a transducer molecule for developmental processes, including segmentation and neuroblast specification. DVL1 is a candidate gene for neuroblastomatous transformation. The Schwartz-Jampel syndrome and Charcot-Marie-Tooth disease type 2A have been mapped to the same region as DVL1. The phenotypes of these diseases may be consistent with defects which might be expected from aberrant expression of a DVL gene during development. [provided by RefSeq, Jul 2008]
Mouse(13542) dishevelled, dsh homolog 1 (Drosophila)
Rat(83721) dishevelled segment polarity protein 1
chicken(419416) dishevelled, dsh homolog 1 (Drosophila)
dog(489593) dishevelled, dsh homolog 1 (Drosophila)
cow(523325) dishevelled, dsh homolog 1 (Drosophila)
domestic cat(101084782) dishevelled, dsh homolog 1 (Drosophila)
sheep(101104259) dishevelled, dsh homolog 1 (Drosophila)
domestic guinea pig(100728748) dishevelled segment polarity protein 1
naked mole-rat(101715426) dishevelled segment polarity protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004421 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004421 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004421 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010091 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010091 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010091 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004421 Rosetta Predictions human pricing
NM_181870 Rosetta Predictions human pricing
NM_182779 Rosetta Predictions human pricing
NM_031820 Rosetta Predictions rat pricing
NM_010091 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142403 predicted 2431
2 SASI_Hs02_00337577 predicted 932
3 SASI_Hs02_00337578 predicted 932
4 SASI_Hs02_00337579 predicted 781
5 SASI_Hs02_00337580 predicted 683
6 SASI_Hs02_00337581 predicted 674
7 SASI_Hs02_00337582 predicted 1226
8 SASI_Hs02_00337583 predicted 800
9 SASI_Hs02_00337584 predicted 750
10 SASI_Hs02_00337585 predicted 609
11 SASI_Hs01_00142401 predicted 2450
12 SASI_Hs01_00142402 predicted 2030
13 SASI_Hs01_00142404 predicted 2546
14 SASI_Hs01_00142405 predicted 2443
15 SASI_Hs01_00142406 predicted 2000
16 SASI_Hs01_00142407 predicted 2233
17 SASI_Hs01_00142408 predicted 1910
18 SASI_Hs01_00142409 predicted 2220
19 SASI_Hs01_00142410 predicted 2503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181870 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052398 predicted 1669
2 SASI_Hs01_00052399 predicted 1248
3 SASI_Hs01_00052400 predicted 1664
4 SASI_Hs01_00052401 predicted 1765
5 SASI_Hs01_00052402 predicted 1660
6 SASI_Hs01_00052403 predicted 1217
7 SASI_Hs01_00052404 predicted 1446
8 SASI_Hs01_00052405 predicted 1135
9 SASI_Hs01_00052406 predicted 1442
10 SASI_Hs01_00052407 predicted 1722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182779 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021784 predicted 1793
2 SASI_Hs01_00021785 predicted 1382
3 SASI_Hs01_00021786 predicted 1781
4 SASI_Hs01_00021787 predicted 1898
5 SASI_Hs01_00021788 predicted 1795
6 SASI_Hs01_00021789 predicted 1350
7 SASI_Hs01_00021790 predicted 1579
8 SASI_Hs01_00021791 predicted 1262
9 SASI_Hs01_00021792 predicted 1560
10 SASI_Hs01_00021793 predicted 1849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031820 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030707 predicted 895
2 SASI_Rn02_00265291 predicted 2063
3 SASI_Rn01_00030709 predicted 1794
4 SASI_Rn01_00030711 predicted 1819
5 SASI_Rn01_00030712 predicted 1473
6 SASI_Rn02_00265292 predicted 910
7 SASI_Rn01_00030713 predicted 1402
8 SASI_Rn01_00030714 predicted 2074
9 SASI_Rn01_00030715 predicted 1863
10 SASI_Rn01_00030716 predicted 1248
11 SASI_Rn01_00030708 predicted 828
12 SASI_Rn01_00030710 predicted 2146
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010091 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148935 predicted 2115
2 SASI_Mm01_00148936 predicted 1796
3 SASI_Mm01_00148937 predicted 2133
4 SASI_Mm01_00148938 predicted 2400
5 SASI_Mm01_00148939 predicted 453
6 SASI_Mm01_00148940 predicted 2393
7 SASI_Mm01_00148941 predicted 1719
8 SASI_Mm01_00148942 predicted 1079
9 SASI_Mm01_00148943 predicted 2181
10 SASI_Mm01_00148944 predicted 1569
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004421
DVL1 MISSION shRNA Bacterial Glycerol Stock
dishevelled segment polarity protein 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-1910s21c1
Sequence:CCGGCACGACCAAGGCCTATACAGTCTCGAGACTGTATAGGCCTTGGTCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-821s21c1
Sequence:CCGGACATCACTTTCTGGGCATCAGCTCGAGCTGATGCCCAGAAAGTGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-456s21c1
Sequence:CCGGACGGAGTCCATGGTCAGTCACCTCGAGGTGACTGACCATGGACTCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-963s21c1
Sequence:CCGGGACGTGAACTTTGAGAACATGCTCGAGCATGTTCTCAAAGTTCACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-1418s21c1
Sequence:CCGGCACGGTCAACAAGATCACCTTCTCGAGAAGGTGATCTTGTTGACCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-433s21c1
Sequence:CCGGACGGGATGGACAACGAGACAGCTCGAGCTGTCTCGTTGTCCATCCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004421.2-2468s21c1
Sequence:CCGGTTTATTGCCTGGCCGGTGACTCTCGAGAGTCACCGGCCAGGCAATAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-764s21c1
Sequence:CCGGCATAACCGACTCCACCATGTCCTCGAGGACATGGTGGAGTCGGTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-1492s21c1
Sequence:CCGGTGAACCTCAACAGTGGCTCCACTCGAGTGGAGCCACTGTTGAGGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-675s21c1
Sequence:CCGGAGCACCTCATCCAGACTCATCCTCGAGGATGAGTCTGGATGAGGTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004421.2-176s1c1
Sequence:CCGGCGCCTACAAATTCTTCTTTAACTCGAGTTAAAGAAGAATTTGTAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004421
DVL1 MISSION shRNA shRNA Plasmid DNA
dishevelled segment polarity protein 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-1910s21c1
Sequence:CCGGCACGACCAAGGCCTATACAGTCTCGAGACTGTATAGGCCTTGGTCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-821s21c1
Sequence:CCGGACATCACTTTCTGGGCATCAGCTCGAGCTGATGCCCAGAAAGTGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-456s21c1
Sequence:CCGGACGGAGTCCATGGTCAGTCACCTCGAGGTGACTGACCATGGACTCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-963s21c1
Sequence:CCGGGACGTGAACTTTGAGAACATGCTCGAGCATGTTCTCAAAGTTCACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-1418s21c1
Sequence:CCGGCACGGTCAACAAGATCACCTTCTCGAGAAGGTGATCTTGTTGACCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-433s21c1
Sequence:CCGGACGGGATGGACAACGAGACAGCTCGAGCTGTCTCGTTGTCCATCCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004421.2-2468s21c1
Sequence:CCGGTTTATTGCCTGGCCGGTGACTCTCGAGAGTCACCGGCCAGGCAATAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-764s21c1
Sequence:CCGGCATAACCGACTCCACCATGTCCTCGAGGACATGGTGGAGTCGGTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-1492s21c1
Sequence:CCGGTGAACCTCAACAGTGGCTCCACTCGAGTGGAGCCACTGTTGAGGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-675s21c1
Sequence:CCGGAGCACCTCATCCAGACTCATCCTCGAGGATGAGTCTGGATGAGGTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004421.2-176s1c1
Sequence:CCGGCGCCTACAAATTCTTCTTTAACTCGAGTTAAAGAAGAATTTGTAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004421
DVL1 MISSION shRNA Lentiviral Transduction Particles
dishevelled segment polarity protein 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-1910s21c1
Sequence:CCGGCACGACCAAGGCCTATACAGTCTCGAGACTGTATAGGCCTTGGTCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-821s21c1
Sequence:CCGGACATCACTTTCTGGGCATCAGCTCGAGCTGATGCCCAGAAAGTGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-456s21c1
Sequence:CCGGACGGAGTCCATGGTCAGTCACCTCGAGGTGACTGACCATGGACTCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-963s21c1
Sequence:CCGGGACGTGAACTTTGAGAACATGCTCGAGCATGTTCTCAAAGTTCACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-1418s21c1
Sequence:CCGGCACGGTCAACAAGATCACCTTCTCGAGAAGGTGATCTTGTTGACCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-433s21c1
Sequence:CCGGACGGGATGGACAACGAGACAGCTCGAGCTGTCTCGTTGTCCATCCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004421.2-2468s21c1
Sequence:CCGGTTTATTGCCTGGCCGGTGACTCTCGAGAGTCACCGGCCAGGCAATAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-764s21c1
Sequence:CCGGCATAACCGACTCCACCATGTCCTCGAGGACATGGTGGAGTCGGTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-1492s21c1
Sequence:CCGGTGAACCTCAACAGTGGCTCCACTCGAGTGGAGCCACTGTTGAGGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004421.2-675s21c1
Sequence:CCGGAGCACCTCATCCAGACTCATCCTCGAGGATGAGTCTGGATGAGGTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004421.2-176s1c1
Sequence:CCGGCGCCTACAAATTCTTCTTTAACTCGAGTTAAAGAAGAATTTGTAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010091
VALIDATED
DVL1 MISSION shRNA Bacterial Glycerol Stock
dishevelled segment polarity protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010091.3-1231s21c1
Sequence:CCGGAGGTGAACGATGTCAACTTTGCTCGAGCAAAGTTGACATCGTTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010091.3-1487s21c1
Sequence:CCGGCACCAGCTCTTCCTCACTAACCTCGAGGTTAGTGAGGAAGAGCTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324649    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010091.3-2579s21c1
Sequence:CCGGCCAGGATATTGGCTTGACATTCTCGAGAATGTCAAGCCAATATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010091.3-452s21c1
Sequence:CCGGCGCCTACAAATTCTTCTTCAACTCGAGTTGAAGAAGAATTTGTAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010091.3-1547s21c1
Sequence:CCGGGCTGACTGTGAAGAGTGACATCTCGAGATGTCACTCTTCACAGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010091.3-1770s1c1
Sequence:CCGGACCGTGAACAAGATCACCTTTCTCGAGAAAGGTGATCTTGTTCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010091.3-452s1c1
Sequence:CCGGCGCCTACAAATTCTTCTTCAACTCGAGTTGAAGAAGAATTTGTAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010091.3-2579s1c1
Sequence:CCGGCCAGGATATTGGCTTGACATTCTCGAGAATGTCAAGCCAATATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010091.3-1547s1c1
Sequence:CCGGGCTGACTGTGAAGAGTGACATCTCGAGATGTCACTCTTCACAGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010091.3-878s1c1
Sequence:CCGGGCTTGAATCTAGCAGCTTTATCTCGAGATAAAGCTGCTAGATTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010091
VALIDATED
DVL1 MISSION shRNA shRNA Plasmid DNA
dishevelled segment polarity protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010091.3-1231s21c1
Sequence:CCGGAGGTGAACGATGTCAACTTTGCTCGAGCAAAGTTGACATCGTTCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010091.3-1487s21c1
Sequence:CCGGCACCAGCTCTTCCTCACTAACCTCGAGGTTAGTGAGGAAGAGCTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324649    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010091.3-2579s21c1
Sequence:CCGGCCAGGATATTGGCTTGACATTCTCGAGAATGTCAAGCCAATATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010091.3-452s21c1
Sequence:CCGGCGCCTACAAATTCTTCTTCAACTCGAGTTGAAGAAGAATTTGTAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010091.3-1547s21c1
Sequence:CCGGGCTGACTGTGAAGAGTGACATCTCGAGATGTCACTCTTCACAGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010091.3-1770s1c1
Sequence:CCGGACCGTGAACAAGATCACCTTTCTCGAGAAAGGTGATCTTGTTCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010091.3-452s1c1
Sequence:CCGGCGCCTACAAATTCTTCTTCAACTCGAGTTGAAGAAGAATTTGTAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010091.3-2579s1c1
Sequence:CCGGCCAGGATATTGGCTTGACATTCTCGAGAATGTCAAGCCAATATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010091.3-1547s1c1
Sequence:CCGGGCTGACTGTGAAGAGTGACATCTCGAGATGTCACTCTTCACAGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010091.3-878s1c1
Sequence:CCGGGCTTGAATCTAGCAGCTTTATCTCGAGATAAAGCTGCTAGATTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010091
VALIDATED
DVL1 MISSION shRNA Lentiviral Transduction Particles
dishevelled segment polarity protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010091.3-1231s21c1
Sequence:CCGGAGGTGAACGATGTCAACTTTGCTCGAGCAAAGTTGACATCGTTCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010091.3-1487s21c1
Sequence:CCGGCACCAGCTCTTCCTCACTAACCTCGAGGTTAGTGAGGAAGAGCTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324649    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010091.3-2579s21c1
Sequence:CCGGCCAGGATATTGGCTTGACATTCTCGAGAATGTCAAGCCAATATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010091.3-452s21c1
Sequence:CCGGCGCCTACAAATTCTTCTTCAACTCGAGTTGAAGAAGAATTTGTAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010091.3-1547s21c1
Sequence:CCGGGCTGACTGTGAAGAGTGACATCTCGAGATGTCACTCTTCACAGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010091.3-1770s1c1
Sequence:CCGGACCGTGAACAAGATCACCTTTCTCGAGAAAGGTGATCTTGTTCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010091.3-452s1c1
Sequence:CCGGCGCCTACAAATTCTTCTTCAACTCGAGTTGAAGAAGAATTTGTAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010091.3-2579s1c1
Sequence:CCGGCCAGGATATTGGCTTGACATTCTCGAGAATGTCAAGCCAATATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010091.3-1547s1c1
Sequence:CCGGGCTGACTGTGAAGAGTGACATCTCGAGATGTCACTCTTCACAGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010091.3-878s1c1
Sequence:CCGGGCTTGAATCTAGCAGCTTTATCTCGAGATAAAGCTGCTAGATTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)