EMAIL THIS PAGE TO A FRIEND

DYX1C1

dyslexia susceptibility 1 candidate 1

112 Gene Product Result for
Synonyms: DYX1 DYXC1 EKN1 RD
UniProtKB ID: Q8WXU2, Q6P5Y9, Q8N1S6
Gene ID:
Human(161582) Summary: This gene encodes a tetratricopeptide repeat domain-containing protein. The encoded protein interacts with estrogen receptors and the heat shock proteins, Hsp70 and Hsp90. An homologous protein in rat has been shown to function in neuronal migration in the developing neocortex. A chromosomal translocation involving this gene is associated with a susceptibility to developmental dyslexia. Mutations in this gene are associated with deficits in reading and spelling. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream cell cycle progression 1 (CCPG1) gene. [provided by RefSeq, Mar 2011]
Mouse(67685) dyslexia susceptibility 1 candidate 1 homolog (human)
Rat(363096) dyslexia susceptibility 1 candidate 1
Zebrafish(402988) dyslexia susceptibility 1 candidate 1
cow(527393) dyslexia susceptibility 1 candidate 1
domestic cat(101085981) dyslexia susceptibility 1 candidate 1
dog(487567) dyslexia susceptibility 1 candidate 1
chicken(415409) dyslexia susceptibility 1 candidate 1
domestic guinea pig(100724579) dyslexia susceptibility 1 candidate 1
naked mole-rat(101716523) dyslexia susceptibility 1 candidate 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026314 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026314 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026314 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_130810 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130810 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130810 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033559 Rosetta Predictions human pricing
NM_001033560 Rosetta Predictions human pricing
NM_130810 Rosetta Predictions human pricing
NM_001007010 Rosetta Predictions rat pricing
XM_001053878 Rosetta Predictions rat pricing
XM_579166 Rosetta Predictions rat pricing
NM_026314 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032089 predicted 453
2 SASI_Hs01_00032090 predicted 396
3 SASI_Hs01_00032092 predicted 458
4 SASI_Hs01_00032093 predicted 1164
5 SASI_Hs01_00032094 predicted 459
6 SASI_Hs01_00032095 predicted 1193
7 SASI_Hs01_00032096 predicted 1173
8 SASI_Hs01_00032097 predicted 481
9 SASI_Hs01_00032098 predicted 477
10 SASI_Hs02_00308051 predicted 380
11 SASI_Hs01_00032091 predicted 1166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033560 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112804 predicted 452
2 SASI_Hs01_00112805 predicted 405
3 SASI_Hs01_00112807 predicted 458
4 SASI_Hs01_00112808 predicted 1165
5 SASI_Hs01_00112809 predicted 453
6 SASI_Hs01_00112810 predicted 1186
7 SASI_Hs01_00112811 predicted 1171
8 SASI_Hs01_00112812 predicted 482
9 SASI_Hs01_00112813 predicted 475
10 SASI_Hs02_00308052 predicted 384
11 SASI_Hs01_00112806 predicted 1169
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056793 predicted 456
2 SASI_Hs01_00056794 predicted 403
3 SASI_Hs01_00056796 predicted 460
4 SASI_Hs01_00056797 predicted 1166
5 SASI_Hs01_00056798 predicted 460
6 SASI_Hs01_00056799 predicted 1188
7 SASI_Hs01_00056800 predicted 1167
8 SASI_Hs01_00056801 predicted 488
9 SASI_Hs01_00056802 predicted 481
10 SASI_Hs02_00362847 predicted 376
11 SASI_Hs01_00056795 predicted 1173
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007010 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198599 predicted 1405
2 SASI_Rn01_00089688 predicted 1036
3 SASI_Rn01_00089689 predicted 1122
4 SASI_Rn01_00089690 predicted 1008
5 SASI_Rn01_00089692 predicted 1335
6 SASI_Rn01_00089693 predicted 1202
7 SASI_Rn01_00089694 predicted 1355
8 SASI_Rn01_00089695 predicted 1102
9 SASI_Rn01_00089696 predicted 902
10 SASI_Rn01_00089697 predicted 1433
11 SASI_Rn01_00089691 predicted 1405
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053878 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273913 predicted 733
2 SASI_Rn02_00273914 predicted 694
3 SASI_Rn02_00273915 predicted 528
4 SASI_Rn02_00273916 predicted 695
5 SASI_Rn02_00273917 predicted 643
6 SASI_Rn02_00273918 predicted 793
7 SASI_Rn02_00273919 predicted 593
8 SASI_Rn02_00273920 predicted 809
9 SASI_Rn02_00273921 predicted 713
10 SASI_Rn02_00273922 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579166 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00135046 predicted 1049
2 SASI_Rn01_00135047 predicted 1127
3 SASI_Rn01_00135048 predicted 1006
4 SASI_Rn01_00135049 predicted 1338
5 SASI_Rn01_00135050 predicted 1343
6 SASI_Rn01_00135051 predicted 1204
7 SASI_Rn01_00135052 predicted 1360
8 SASI_Rn01_00135053 predicted 1108
9 SASI_Rn01_00135054 predicted 1243
10 SASI_Rn01_00135055 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026314 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156161 predicted 1393
2 SASI_Mm01_00156163 predicted 994
3 SASI_Mm01_00156164 predicted 1007
4 SASI_Mm01_00156165 predicted 1165
5 SASI_Mm01_00156166 predicted 869
6 SASI_Mm02_00330016 predicted 1194
7 SASI_Mm01_00156170 predicted 1253
8 SASI_Mm02_00330017 predicted 1285
9 SASI_Mm02_00330018 predicted 953
10 SASI_Mm02_00330019 predicted 1259
11 SASI_Mm01_00156162 predicted 911
12 SASI_Mm01_00156167 predicted 964
13 SASI_Mm01_00156168 predicted 1261
14 SASI_Mm01_00156169 predicted 871
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026314
DYX1C1 MISSION shRNA Bacterial Glycerol Stock
dyslexia susceptibility 1 candidate 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114186    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026314.2-1601s1c1
Sequence:CCGGGCCAGGATACTACTGAGGAATCTCGAGATTCCTCAGTAGTATCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026314.2-197s1c1
Sequence:CCGGGCTGTTTCTCTATGCTCCCATCTCGAGATGGGAGCATAGAGAAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026314.2-966s1c1
Sequence:CCGGGCGGTTGATGCATATAATTTACTCGAGTAAATTATATGCATCAACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026314.2-748s1c1
Sequence:CCGGGCAGTATTCAAATCAGCTTTACTCGAGTAAAGCTGATTTGAATACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026314.2-1257s1c1
Sequence:CCGGGCAGAGAAGATTCGGAATATACTCGAGTATATTCCGAATCTTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026314
DYX1C1 MISSION shRNA shRNA Plasmid DNA
dyslexia susceptibility 1 candidate 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114186    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026314.2-1601s1c1
Sequence:CCGGGCCAGGATACTACTGAGGAATCTCGAGATTCCTCAGTAGTATCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026314.2-197s1c1
Sequence:CCGGGCTGTTTCTCTATGCTCCCATCTCGAGATGGGAGCATAGAGAAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026314.2-966s1c1
Sequence:CCGGGCGGTTGATGCATATAATTTACTCGAGTAAATTATATGCATCAACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026314.2-748s1c1
Sequence:CCGGGCAGTATTCAAATCAGCTTTACTCGAGTAAAGCTGATTTGAATACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026314.2-1257s1c1
Sequence:CCGGGCAGAGAAGATTCGGAATATACTCGAGTATATTCCGAATCTTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026314
DYX1C1 MISSION shRNA Lentiviral Transduction Particles
dyslexia susceptibility 1 candidate 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114186    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026314.2-1601s1c1
Sequence:CCGGGCCAGGATACTACTGAGGAATCTCGAGATTCCTCAGTAGTATCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026314.2-197s1c1
Sequence:CCGGGCTGTTTCTCTATGCTCCCATCTCGAGATGGGAGCATAGAGAAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026314.2-966s1c1
Sequence:CCGGGCGGTTGATGCATATAATTTACTCGAGTAAATTATATGCATCAACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026314.2-748s1c1
Sequence:CCGGGCAGTATTCAAATCAGCTTTACTCGAGTAAAGCTGATTTGAATACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026314.2-1257s1c1
Sequence:CCGGGCAGAGAAGATTCGGAATATACTCGAGTATATTCCGAATCTTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130810
DYX1C1 MISSION shRNA Bacterial Glycerol Stock
dyslexia susceptibility 1 candidate 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130810.1-1236s1c1
Sequence:CCGGCCAGAATGGTTGAAGGATAAACTCGAGTTTATCCTTCAACCATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130810.1-1584s1c1
Sequence:CCGGGCTGAGAAGATTCGGAATGTACTCGAGTACATTCCGAATCTTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130810.1-1540s1c1
Sequence:CCGGCGGCACTTAAGATTGATCCATCTCGAGATGGATCAATCTTAAGTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139891    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130810.1-1705s1c1
Sequence:CCGGGCCAGTTGTACAGAATCGCTTCTCGAGAAGCGATTCTGTACAACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130810.1-1527s1c1
Sequence:CCGGCAGGATTATGAAGCGGCACTTCTCGAGAAGTGCCGCTTCATAATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130810.1-632s1c1
Sequence:CCGGGACGGGTGTTGACAAAGAGATCTCGAGATCTCTTTGTCAACACCCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140996    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130810.1-1706s1c1
Sequence:CCGGCCAGTTGTACAGAATCGCTTTCTCGAGAAAGCGATTCTGTACAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130810.1-1122s1c1
Sequence:CCGGCGTGAATCACAAGTAGCAGAACTCGAGTTCTGCTACTTGTGATTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130810.1-981s1c1
Sequence:CCGGGCATCTAGAAATCTTGCTCCACTCGAGTGGAGCAAGATTTCTAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130810.1-1437s1c1
Sequence:CCGGCCTGTTACAGACAATGCTAATCTCGAGATTAGCATTGTCTGTAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130810.1-519s1c1
Sequence:CCGGGCATTTCTTTATGCTCCCATACTCGAGTATGGGAGCATAAAGAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130810.1-849s1c1
Sequence:CCGGGCCTGGAAAGAATATCAAAGACTCGAGTCTTTGATATTCTTTCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130810.1-1489s1c1
Sequence:CCGGCAGCATTCTGTCAACTAGAATCTCGAGATTCTAGTTGACAGAATGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130810
DYX1C1 MISSION shRNA shRNA Plasmid DNA
dyslexia susceptibility 1 candidate 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130810.1-1236s1c1
Sequence:CCGGCCAGAATGGTTGAAGGATAAACTCGAGTTTATCCTTCAACCATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130810.1-1584s1c1
Sequence:CCGGGCTGAGAAGATTCGGAATGTACTCGAGTACATTCCGAATCTTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130810.1-1540s1c1
Sequence:CCGGCGGCACTTAAGATTGATCCATCTCGAGATGGATCAATCTTAAGTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139891    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130810.1-1705s1c1
Sequence:CCGGGCCAGTTGTACAGAATCGCTTCTCGAGAAGCGATTCTGTACAACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130810.1-1527s1c1
Sequence:CCGGCAGGATTATGAAGCGGCACTTCTCGAGAAGTGCCGCTTCATAATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130810.1-632s1c1
Sequence:CCGGGACGGGTGTTGACAAAGAGATCTCGAGATCTCTTTGTCAACACCCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140996    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130810.1-1706s1c1
Sequence:CCGGCCAGTTGTACAGAATCGCTTTCTCGAGAAAGCGATTCTGTACAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130810.1-1122s1c1
Sequence:CCGGCGTGAATCACAAGTAGCAGAACTCGAGTTCTGCTACTTGTGATTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130810.1-981s1c1
Sequence:CCGGGCATCTAGAAATCTTGCTCCACTCGAGTGGAGCAAGATTTCTAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130810.1-1437s1c1
Sequence:CCGGCCTGTTACAGACAATGCTAATCTCGAGATTAGCATTGTCTGTAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130810.1-519s1c1
Sequence:CCGGGCATTTCTTTATGCTCCCATACTCGAGTATGGGAGCATAAAGAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130810.1-849s1c1
Sequence:CCGGGCCTGGAAAGAATATCAAAGACTCGAGTCTTTGATATTCTTTCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130810.1-1489s1c1
Sequence:CCGGCAGCATTCTGTCAACTAGAATCTCGAGATTCTAGTTGACAGAATGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130810
DYX1C1 MISSION shRNA Lentiviral Transduction Particles
dyslexia susceptibility 1 candidate 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130810.1-1236s1c1
Sequence:CCGGCCAGAATGGTTGAAGGATAAACTCGAGTTTATCCTTCAACCATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130810.1-1584s1c1
Sequence:CCGGGCTGAGAAGATTCGGAATGTACTCGAGTACATTCCGAATCTTCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130810.1-1540s1c1
Sequence:CCGGCGGCACTTAAGATTGATCCATCTCGAGATGGATCAATCTTAAGTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139891    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130810.1-1705s1c1
Sequence:CCGGGCCAGTTGTACAGAATCGCTTCTCGAGAAGCGATTCTGTACAACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130810.1-1527s1c1
Sequence:CCGGCAGGATTATGAAGCGGCACTTCTCGAGAAGTGCCGCTTCATAATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130810.1-632s1c1
Sequence:CCGGGACGGGTGTTGACAAAGAGATCTCGAGATCTCTTTGTCAACACCCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140996    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130810.1-1706s1c1
Sequence:CCGGCCAGTTGTACAGAATCGCTTTCTCGAGAAAGCGATTCTGTACAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130810.1-1122s1c1
Sequence:CCGGCGTGAATCACAAGTAGCAGAACTCGAGTTCTGCTACTTGTGATTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130810.1-981s1c1
Sequence:CCGGGCATCTAGAAATCTTGCTCCACTCGAGTGGAGCAAGATTTCTAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130810.1-1437s1c1
Sequence:CCGGCCTGTTACAGACAATGCTAATCTCGAGATTAGCATTGTCTGTAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130810.1-519s1c1
Sequence:CCGGGCATTTCTTTATGCTCCCATACTCGAGTATGGGAGCATAAAGAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130810.1-849s1c1
Sequence:CCGGGCCTGGAAAGAATATCAAAGACTCGAGTCTTTGATATTCTTTCCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130810.1-1489s1c1
Sequence:CCGGCAGCATTCTGTCAACTAGAATCTCGAGATTCTAGTTGACAGAATGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)