EMAIL THIS PAGE TO A FRIEND

E2F1

E2F transcription factor 1

174 Gene Product Result for
Synonyms: E2F-1 RBAP1 RBBP3 RBP3
UniProtKB ID: Q01094, Q13143, Q92768
Gene ID:
Human(1869) Summary: The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein and another 2 members, E2F2 and E2F3, have an additional cyclin binding domain. This protein binds preferentially to retinoblastoma protein pRB in a cell-cycle dependent manner. It can mediate both cell proliferation and p53-dependent/independent apoptosis. [provided by RefSeq, Jul 2008]
Mouse(13555) E2F transcription factor 1
Rat(399489) E2F transcription factor 1
Thale Cress(832283) E2F transcription factor 1
cow(535369) E2F transcription factor 1
Horse(100069192) E2F transcription factor 1
domestic cat(101098454) E2F transcription factor 1
dog(485839) E2F transcription factor 1
chicken(396142) E2F transcription factor 1
domestic guinea pig(100729531) E2F transcription factor 1
naked mole-rat(101717980) E2F transcription factor 1
sheep(101117526) E2F transcription factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV04006 Anti-E2F1 (AB1) antibody produced in rabbit affinity isolated antibody guinea pig, mouse, rat, canine, rabbit, horse, human
western blot pricing
SAB2502110 Anti-E2F1 antibody produced in goat affinity isolated antibody, buffered aqueous solution Drosophila
ELISA, immunofluorescence pricing
AV100822 Anti-E2F1 antibody produced in rabbit IgG fraction of antiserum human
immunohistochemistry, western blot pricing
HPA008003 Anti-E2F1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
E9026 Anti-E2F1 antibody produced in rabbit ~0.8 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunoprecipitation (IP), microarray, western blot pricing
HPA029735 Anti-E2F1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB2103144 Anti-E2F1, (N-terminal) antibody produced in rabbit affinity isolated antibody rat, horse, rabbit, bovine, guinea pig, human, mouse, canine
western blot pricing
SAB4500682 Anti-E2F1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
SAB4503867 Anti-phospho-E2F1 (pThr433) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4301502 Anti-phospho-E2F1 (pThr433) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
WH0001869M1 Monoclonal Anti-E2F1 antibody produced in mouse clone 2E10, purified immunoglobulin, buffered aqueous solution human
ELISA, proximity ligation assay, western blot pricing
E8901 Monoclonal Anti-E2F1 antibody produced in mouse ~0.5 mg/mL, clone KH20, purified immunoglobulin, buffered aqueous solution human, rat, Xenopus, mouse
immunoprecipitation (IP), microarray, western blot pricing
PLA0139 Rabbit anti-E2F1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. guinea pig, rabbit, dog, rhesus monkey, primate, human, rat, mouse, bovine, pig, horse
immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007891 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007891 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007891 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005225 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005225 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005225 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005225 Rosetta Predictions human pricing
NM_001100778 Rosetta Predictions rat pricing
NM_007891 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162220 predicted 1325
2 SASI_Hs01_00162222 predicted 908
3 SASI_Hs01_00162223 predicted 1003
4 SASI_Hs01_00162224 predicted 1105
5 SASI_Hs01_00162225 predicted 953
6 SASI_Hs01_00162226 predicted 1395
7 SASI_Hs02_00339213 predicted 1046
8 SASI_Hs01_00162227 predicted 1204
9 SASI_Hs01_00162228 predicted 798
10 SASI_Hs01_00162229 predicted 1925
11 SASI_Hs01_00162221 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100778 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210528 predicted 1194
2 SASI_Rn02_00210529 predicted 685
3 SASI_Rn02_00210530 predicted 1392
4 SASI_Rn02_00210531 predicted 828
5 SASI_Rn02_00210532 predicted 543
6 SASI_Rn02_00210533 predicted 520
7 SASI_Rn02_00210534 predicted 940
8 SASI_Rn02_00210535 predicted 581
9 SASI_Rn02_00210536 predicted 951
10 SASI_Rn02_00210537 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007891 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118452 predicted 765
2 SASI_Mm01_00118453 predicted 532
3 SASI_Mm01_00118454 predicted 1351
4 SASI_Mm01_00118455 predicted 357
5 SASI_Mm01_00118456 predicted 506
6 SASI_Mm01_00118457 predicted 1316
7 SASI_Mm01_00118458 predicted 915
8 SASI_Mm01_00118459 predicted 903
9 SASI_Mm02_00312680 predicted 942
10 SASI_Mm01_00118460 predicted 943
11 SASI_Mm01_00118461 predicted 493
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007891
VALIDATED
E2F1 MISSION shRNA Bacterial Glycerol Stock
E2F transcription factor 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007891.1-915s1c1
Sequence:CCGGCCCAACTACAAGCTGTGGATTCTCGAGAATCCACAGCTTGTAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007891.1-644s1c1
Sequence:CCGGGCCAAGAAGTCCAAGAATCATCTCGAGATGATTCTTGGACTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007891.1-482s1c1
Sequence:CCGGCGCTATGAAACCTCACTAAATCTCGAGATTTAGTGAGGTTTCATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007891.1-1364s1c1
Sequence:CCGGGATCTCTTTGACTGTGACTTTCTCGAGAAAGTCACAGTCAAAGAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007891.1-1319s1c1
Sequence:CCGGGCCCTTGACTATCACTTTGGTCTCGAGACCAAAGTGATAGTCAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007891.4-873s21c1
Sequence:CCGGCTGCAGAACAGATGGTCATAGCTCGAGCTATGACCATCTGTTCTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007891.4-481s21c1
Sequence:CCGGACGCTATGAAACCTCACTAAACTCGAGTTTAGTGAGGTTTCATAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007891.4-1240s21c1
Sequence:CCGGCTCACTCCTGGAGCATGTTAACTCGAGTTAACATGCTCCAGGAGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312761    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007891.4-1514s21c1
Sequence:CCGGCCATACCCTCTGTCCCAATAGCTCGAGCTATTGGGACAGAGGGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007891.4-644s21c1
Sequence:CCGGGCCAAGAAGTCCAAGAATCATCTCGAGATGATTCTTGGACTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007891.4-1317s21c1
Sequence:CCGGAGGCCCTTGACTATCACTTTGCTCGAGCAAAGTGATAGTCAAGGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007891
VALIDATED
E2F1 MISSION shRNA shRNA Plasmid DNA
E2F transcription factor 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007891.1-915s1c1
Sequence:CCGGCCCAACTACAAGCTGTGGATTCTCGAGAATCCACAGCTTGTAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007891.1-644s1c1
Sequence:CCGGGCCAAGAAGTCCAAGAATCATCTCGAGATGATTCTTGGACTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007891.1-482s1c1
Sequence:CCGGCGCTATGAAACCTCACTAAATCTCGAGATTTAGTGAGGTTTCATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007891.1-1364s1c1
Sequence:CCGGGATCTCTTTGACTGTGACTTTCTCGAGAAAGTCACAGTCAAAGAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007891.1-1319s1c1
Sequence:CCGGGCCCTTGACTATCACTTTGGTCTCGAGACCAAAGTGATAGTCAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007891.4-873s21c1
Sequence:CCGGCTGCAGAACAGATGGTCATAGCTCGAGCTATGACCATCTGTTCTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007891.4-481s21c1
Sequence:CCGGACGCTATGAAACCTCACTAAACTCGAGTTTAGTGAGGTTTCATAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007891.4-1240s21c1
Sequence:CCGGCTCACTCCTGGAGCATGTTAACTCGAGTTAACATGCTCCAGGAGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312761    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007891.4-1514s21c1
Sequence:CCGGCCATACCCTCTGTCCCAATAGCTCGAGCTATTGGGACAGAGGGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007891.4-644s21c1
Sequence:CCGGGCCAAGAAGTCCAAGAATCATCTCGAGATGATTCTTGGACTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007891.4-1317s21c1
Sequence:CCGGAGGCCCTTGACTATCACTTTGCTCGAGCAAAGTGATAGTCAAGGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007891
VALIDATED
E2F1 MISSION shRNA Lentiviral Transduction Particles
E2F transcription factor 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007891.1-915s1c1
Sequence:CCGGCCCAACTACAAGCTGTGGATTCTCGAGAATCCACAGCTTGTAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007891.1-644s1c1
Sequence:CCGGGCCAAGAAGTCCAAGAATCATCTCGAGATGATTCTTGGACTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007891.1-482s1c1
Sequence:CCGGCGCTATGAAACCTCACTAAATCTCGAGATTTAGTGAGGTTTCATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007891.1-1364s1c1
Sequence:CCGGGATCTCTTTGACTGTGACTTTCTCGAGAAAGTCACAGTCAAAGAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007891.1-1319s1c1
Sequence:CCGGGCCCTTGACTATCACTTTGGTCTCGAGACCAAAGTGATAGTCAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007891.4-873s21c1
Sequence:CCGGCTGCAGAACAGATGGTCATAGCTCGAGCTATGACCATCTGTTCTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007891.4-481s21c1
Sequence:CCGGACGCTATGAAACCTCACTAAACTCGAGTTTAGTGAGGTTTCATAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007891.4-1240s21c1
Sequence:CCGGCTCACTCCTGGAGCATGTTAACTCGAGTTAACATGCTCCAGGAGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312761    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007891.4-1514s21c1
Sequence:CCGGCCATACCCTCTGTCCCAATAGCTCGAGCTATTGGGACAGAGGGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007891.4-644s21c1
Sequence:CCGGGCCAAGAAGTCCAAGAATCATCTCGAGATGATTCTTGGACTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007891.4-1317s21c1
Sequence:CCGGAGGCCCTTGACTATCACTTTGCTCGAGCAAAGTGATAGTCAAGGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005225
VALIDATED
E2F1 MISSION shRNA Bacterial Glycerol Stock
E2F transcription factor 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.1-1309s1c1
Sequence:CCGGCCTGAGGAGTTCATCAGCCTTCTCGAGAAGGCTGATGAACTCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.1-788s1c1
Sequence:CCGGACCTGATGAATATCTGTACTACTCGAGTAGTACAGATATTCATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.1-948s1c1
Sequence:CCGGCGTGGACTCTTCGGAGAACTTCTCGAGAAGTTCTCCGAAGAGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.1-502s1c1
Sequence:CCGGCGCTATGAGACCTCACTGAATCTCGAGATTCAGTGAGGTCTCATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039658    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.1-2264s1c1
Sequence:CCGGCAGGATGGATATGAGATGGGACTCGAGTCCCATCTCATATCCATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.x-628s1c1
Sequence:CCGGACATCACCAACGTCCTTGAGCTCGAGCTCAAGGACGTTGGTGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.x-1171s1c1
Sequence:CCGGCTACTCAGCCTGGAGCAAGAACTCGAGTTCTTGCTCCAGGCTGAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.x-981s1c1
Sequence:CCGGTAAGAGCAAACAAGGCCCGATCTCGAGATCGGGCCTTGTTTGCTCTTATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.x-651s1c1
Sequence:CCGGCATCCAGCTCATTGCCAAGAACTCGAGTTCTTGGCAATGAGCTGGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.x-1819s1c1
Sequence:CCGGTAACTGCACTTTCGGCCCTTTCTCGAGAAAGGGCCGAAAGTGCAGTTATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005225.2-1408s21c1
Sequence:CCGGACCTCTTCGACTGTGACTTTGCTCGAGCAAAGTCACAGTCGAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005225.2-519s21c1
Sequence:CCGGCGCTATGAGACCTCACTGAATCTCGAGATTCAGTGAGGTCTCATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005225.2-2281s21c1
Sequence:CCGGCAGGATGGATATGAGATGGGACTCGAGTCCCATCTCATATCCATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005225.2-805s21c1
Sequence:CCGGACCTGATGAATATCTGTACTACTCGAGTAGTACAGATATTCATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005225.2-965s21c1
Sequence:CCGGCGTGGACTCTTCGGAGAACTTCTCGAGAAGTTCTCCGAAGAGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005225
VALIDATED
E2F1 MISSION shRNA shRNA Plasmid DNA
E2F transcription factor 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.1-1309s1c1
Sequence:CCGGCCTGAGGAGTTCATCAGCCTTCTCGAGAAGGCTGATGAACTCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.1-788s1c1
Sequence:CCGGACCTGATGAATATCTGTACTACTCGAGTAGTACAGATATTCATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.1-948s1c1
Sequence:CCGGCGTGGACTCTTCGGAGAACTTCTCGAGAAGTTCTCCGAAGAGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.1-502s1c1
Sequence:CCGGCGCTATGAGACCTCACTGAATCTCGAGATTCAGTGAGGTCTCATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039658    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.1-2264s1c1
Sequence:CCGGCAGGATGGATATGAGATGGGACTCGAGTCCCATCTCATATCCATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.x-628s1c1
Sequence:CCGGACATCACCAACGTCCTTGAGCTCGAGCTCAAGGACGTTGGTGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.x-1171s1c1
Sequence:CCGGCTACTCAGCCTGGAGCAAGAACTCGAGTTCTTGCTCCAGGCTGAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.x-981s1c1
Sequence:CCGGTAAGAGCAAACAAGGCCCGATCTCGAGATCGGGCCTTGTTTGCTCTTATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.x-651s1c1
Sequence:CCGGCATCCAGCTCATTGCCAAGAACTCGAGTTCTTGGCAATGAGCTGGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.x-1819s1c1
Sequence:CCGGTAACTGCACTTTCGGCCCTTTCTCGAGAAAGGGCCGAAAGTGCAGTTATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005225.2-1408s21c1
Sequence:CCGGACCTCTTCGACTGTGACTTTGCTCGAGCAAAGTCACAGTCGAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005225.2-519s21c1
Sequence:CCGGCGCTATGAGACCTCACTGAATCTCGAGATTCAGTGAGGTCTCATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005225.2-2281s21c1
Sequence:CCGGCAGGATGGATATGAGATGGGACTCGAGTCCCATCTCATATCCATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005225.2-805s21c1
Sequence:CCGGACCTGATGAATATCTGTACTACTCGAGTAGTACAGATATTCATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005225.2-965s21c1
Sequence:CCGGCGTGGACTCTTCGGAGAACTTCTCGAGAAGTTCTCCGAAGAGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005225
VALIDATED
E2F1 MISSION shRNA Lentiviral Transduction Particles
E2F transcription factor 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.1-1309s1c1
Sequence:CCGGCCTGAGGAGTTCATCAGCCTTCTCGAGAAGGCTGATGAACTCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.1-788s1c1
Sequence:CCGGACCTGATGAATATCTGTACTACTCGAGTAGTACAGATATTCATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.1-948s1c1
Sequence:CCGGCGTGGACTCTTCGGAGAACTTCTCGAGAAGTTCTCCGAAGAGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.1-502s1c1
Sequence:CCGGCGCTATGAGACCTCACTGAATCTCGAGATTCAGTGAGGTCTCATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039658    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.1-2264s1c1
Sequence:CCGGCAGGATGGATATGAGATGGGACTCGAGTCCCATCTCATATCCATCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.x-628s1c1
Sequence:CCGGACATCACCAACGTCCTTGAGCTCGAGCTCAAGGACGTTGGTGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.x-1171s1c1
Sequence:CCGGCTACTCAGCCTGGAGCAAGAACTCGAGTTCTTGCTCCAGGCTGAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.x-981s1c1
Sequence:CCGGTAAGAGCAAACAAGGCCCGATCTCGAGATCGGGCCTTGTTTGCTCTTATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.x-651s1c1
Sequence:CCGGCATCCAGCTCATTGCCAAGAACTCGAGTTCTTGGCAATGAGCTGGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005225.x-1819s1c1
Sequence:CCGGTAACTGCACTTTCGGCCCTTTCTCGAGAAAGGGCCGAAAGTGCAGTTATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005225.2-1408s21c1
Sequence:CCGGACCTCTTCGACTGTGACTTTGCTCGAGCAAAGTCACAGTCGAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005225.2-519s21c1
Sequence:CCGGCGCTATGAGACCTCACTGAATCTCGAGATTCAGTGAGGTCTCATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005225.2-2281s21c1
Sequence:CCGGCAGGATGGATATGAGATGGGACTCGAGTCCCATCTCATATCCATCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005225.2-805s21c1
Sequence:CCGGACCTGATGAATATCTGTACTACTCGAGTAGTACAGATATTCATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005225.2-965s21c1
Sequence:CCGGCGTGGACTCTTCGGAGAACTTCTCGAGAAGTTCTCCGAAGAGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)