EMAIL THIS PAGE TO A FRIEND

E2F8

E2F transcription factor 8

96 Gene Product Result for
Synonyms: E2F-8
Gene ID:
Human(79733) Summary: This gene encodes a member of a family of transcription factors which regulate the expression of genes required for progression through the cell cycle. The encoded protein regulates progression from G1 to S phase by ensuring the nucleus divides at the proper time. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2012]
Mouse(108961) E2F transcription factor 8
Rat(308607) E2F transcription factor 8
sheep(101115742) E2F transcription factor 8
Domestic Rabbit(100350717) E2F transcription factor 8
naked mole-rat(101722672) E2F transcription factor 8
domestic guinea pig(100723781) E2F transcription factor 8
Zebrafish(565952) E2F transcription factor 8
cow(786629) E2F transcription factor 8
Horse(100071962) E2F transcription factor 8
domestic cat(101082690) E2F transcription factor 8
dog(476885) E2F transcription factor 8
chicken(422978) E2F transcription factor 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024680 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024680 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024680 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013368 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013368 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013368 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024680 Rosetta Predictions human pricing
XM_001080259 Rosetta Predictions rat pricing
XM_001080267 Rosetta Predictions rat pricing
XM_218601 Rosetta Predictions rat pricing
NM_001013368 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357112 predicted 2958
2 SASI_Hs01_00083537 predicted 986
3 SASI_Hs01_00083538 predicted 1273
4 SASI_Hs01_00083539 predicted 2619
5 SASI_Hs01_00083540 predicted 796
6 SASI_Hs01_00083541 predicted 1782
7 SASI_Hs01_00083542 predicted 1866
8 SASI_Hs01_00083543 predicted 2075
9 SASI_Hs01_00083544 predicted 1679
10 SASI_Hs02_00357113 predicted 1377
11 SASI_Hs01_00083535 predicted 1201
12 SASI_Hs01_00083536 predicted 1470
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080259 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367330 predicted 1356
2 SASI_Rn02_00367331 predicted 1695
3 SASI_Rn02_00367332 predicted 2778
4 SASI_Rn02_00367333 predicted 2074
5 SASI_Rn02_00367334 predicted 1568
6 SASI_Rn02_00367335 predicted 2699
7 SASI_Rn02_00367336 predicted 595
8 SASI_Rn02_00367337 predicted 1864
9 SASI_Rn02_00367338 predicted 1486
10 SASI_Rn02_00367339 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080267 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367375 predicted 2222
2 SASI_Rn02_00367376 predicted 2568
3 SASI_Rn02_00367377 predicted 3651
4 SASI_Rn02_00367378 predicted 2938
5 SASI_Rn02_00367379 predicted 2444
6 SASI_Rn02_00367380 predicted 1457
7 SASI_Rn02_00367381 predicted 2732
8 SASI_Rn02_00367382 predicted 2360
9 SASI_Rn02_00367383 predicted 1443
10 SASI_Rn02_00367384 predicted 2365
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377861 predicted 945
2 SASI_Rn02_00377862 predicted 987
3 SASI_Rn02_00377863 predicted 984
4 SASI_Rn02_00377864 predicted 277
5 SASI_Rn02_00377865 predicted 1010
6 SASI_Rn02_00377866 predicted 237
7 SASI_Rn02_00377867 predicted 809
8 SASI_Rn02_00377868 predicted 1041
9 SASI_Rn02_00377869 predicted 296
10 SASI_Rn02_00377870 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013368 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197150 predicted 1999
2 SASI_Mm01_00197152 predicted 1835
3 SASI_Mm01_00197153 predicted 1494
4 SASI_Mm01_00197154 predicted 731
5 SASI_Mm02_00287174 predicted 1156
6 SASI_Mm01_00197155 predicted 2188
7 SASI_Mm01_00197156 predicted 1303
8 SASI_Mm01_00197157 predicted 2449
9 SASI_Mm02_00287175 predicted 744
10 SASI_Mm01_00197159 predicted 2731
11 SASI_Mm01_00197151 predicted 1489
12 SASI_Mm01_00197158 predicted 552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024680
VALIDATED
E2F8 MISSION shRNA Bacterial Glycerol Stock
E2F transcription factor 8
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-1676s21c1
Sequence:CCGGCACGTGGGAAACCAAACTTTACTCGAGTAAAGTTTGGTTTCCCACGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-1456s21c1
Sequence:CCGGATTAGGAGGTTGTATGATATACTCGAGTATATCATACAACCTCCTAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024680.2-3133s21c1
Sequence:CCGGGATGTTGGCTTAGTTTAATTTCTCGAGAAATTAAACTAAGCCAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-3107s21c1
Sequence:CCGGCAACAGAGGATGTCCATTAATCTCGAGATTAATGGACATCCTCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-1191s21c1
Sequence:CCGGTTACAGTATAGAGGATCATATCTCGAGATATGATCCTCTATACTGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-1359s21c1
Sequence:CCGGGTCAACGCCTCAGATAGTAAGCTCGAGCTTACTATCTGAGGCGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-1831s21c1
Sequence:CCGGATGGCTCAGCTCGCAGCTATTCTCGAGAATAGCTGCGAGCTGAGCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-1382s21c1
Sequence:CCGGTAGAAGTTGCTGCCAAGATTTCTCGAGAAATCTTGGCAGCAACTTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-1738s21c1
Sequence:CCGGAGTGATCGGAGAAAGATAAATCTCGAGATTTATCTTTCTCCGATCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-976s21c1
Sequence:CCGGGTTGAACGTCGACGCATTTACCTCGAGGTAAATGCGTCGACGTTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024680.2-1301s1c1
Sequence:CCGGGCCGCAAAGACAAGTCTTTAACTCGAGTTAAAGACTTGTCTTTGCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024680.2-1562s1c1
Sequence:CCGGGCCCAGAAATCAGTCCAAATACTCGAGTATTTGGACTGATTTCTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024680.2-2570s1c1
Sequence:CCGGCTGAACTCACTGCTGTTAATTCTCGAGAATTAACAGCAGTGAGTTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024680.2-889s1c1
Sequence:CCGGCATAAGTTCTTAGCACGATATCTCGAGATATCGTGCTAAGAACTTATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024680.2-1128s1c1
Sequence:CCGGCGCCGAGCAGATTATGATGATCTCGAGATCATCATAATCTGCTCGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024680
VALIDATED
E2F8 MISSION shRNA shRNA Plasmid DNA
E2F transcription factor 8
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-1676s21c1
Sequence:CCGGCACGTGGGAAACCAAACTTTACTCGAGTAAAGTTTGGTTTCCCACGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-1456s21c1
Sequence:CCGGATTAGGAGGTTGTATGATATACTCGAGTATATCATACAACCTCCTAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024680.2-3133s21c1
Sequence:CCGGGATGTTGGCTTAGTTTAATTTCTCGAGAAATTAAACTAAGCCAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-3107s21c1
Sequence:CCGGCAACAGAGGATGTCCATTAATCTCGAGATTAATGGACATCCTCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-1191s21c1
Sequence:CCGGTTACAGTATAGAGGATCATATCTCGAGATATGATCCTCTATACTGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-1359s21c1
Sequence:CCGGGTCAACGCCTCAGATAGTAAGCTCGAGCTTACTATCTGAGGCGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-1831s21c1
Sequence:CCGGATGGCTCAGCTCGCAGCTATTCTCGAGAATAGCTGCGAGCTGAGCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-1382s21c1
Sequence:CCGGTAGAAGTTGCTGCCAAGATTTCTCGAGAAATCTTGGCAGCAACTTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-1738s21c1
Sequence:CCGGAGTGATCGGAGAAAGATAAATCTCGAGATTTATCTTTCTCCGATCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-976s21c1
Sequence:CCGGGTTGAACGTCGACGCATTTACCTCGAGGTAAATGCGTCGACGTTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024680.2-1301s1c1
Sequence:CCGGGCCGCAAAGACAAGTCTTTAACTCGAGTTAAAGACTTGTCTTTGCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024680.2-1562s1c1
Sequence:CCGGGCCCAGAAATCAGTCCAAATACTCGAGTATTTGGACTGATTTCTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024680.2-2570s1c1
Sequence:CCGGCTGAACTCACTGCTGTTAATTCTCGAGAATTAACAGCAGTGAGTTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024680.2-889s1c1
Sequence:CCGGCATAAGTTCTTAGCACGATATCTCGAGATATCGTGCTAAGAACTTATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024680.2-1128s1c1
Sequence:CCGGCGCCGAGCAGATTATGATGATCTCGAGATCATCATAATCTGCTCGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024680
VALIDATED
E2F8 MISSION shRNA Lentiviral Transduction Particles
E2F transcription factor 8
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-1676s21c1
Sequence:CCGGCACGTGGGAAACCAAACTTTACTCGAGTAAAGTTTGGTTTCCCACGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-1456s21c1
Sequence:CCGGATTAGGAGGTTGTATGATATACTCGAGTATATCATACAACCTCCTAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024680.2-3133s21c1
Sequence:CCGGGATGTTGGCTTAGTTTAATTTCTCGAGAAATTAAACTAAGCCAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-3107s21c1
Sequence:CCGGCAACAGAGGATGTCCATTAATCTCGAGATTAATGGACATCCTCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-1191s21c1
Sequence:CCGGTTACAGTATAGAGGATCATATCTCGAGATATGATCCTCTATACTGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-1359s21c1
Sequence:CCGGGTCAACGCCTCAGATAGTAAGCTCGAGCTTACTATCTGAGGCGTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-1831s21c1
Sequence:CCGGATGGCTCAGCTCGCAGCTATTCTCGAGAATAGCTGCGAGCTGAGCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-1382s21c1
Sequence:CCGGTAGAAGTTGCTGCCAAGATTTCTCGAGAAATCTTGGCAGCAACTTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-1738s21c1
Sequence:CCGGAGTGATCGGAGAAAGATAAATCTCGAGATTTATCTTTCTCCGATCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024680.2-976s21c1
Sequence:CCGGGTTGAACGTCGACGCATTTACCTCGAGGTAAATGCGTCGACGTTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024680.2-1301s1c1
Sequence:CCGGGCCGCAAAGACAAGTCTTTAACTCGAGTTAAAGACTTGTCTTTGCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024680.2-1562s1c1
Sequence:CCGGGCCCAGAAATCAGTCCAAATACTCGAGTATTTGGACTGATTTCTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024680.2-2570s1c1
Sequence:CCGGCTGAACTCACTGCTGTTAATTCTCGAGAATTAACAGCAGTGAGTTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024680.2-889s1c1
Sequence:CCGGCATAAGTTCTTAGCACGATATCTCGAGATATCGTGCTAAGAACTTATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024680.2-1128s1c1
Sequence:CCGGCGCCGAGCAGATTATGATGATCTCGAGATCATCATAATCTGCTCGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013368
VALIDATED
E2F8 MISSION shRNA Bacterial Glycerol Stock
E2F transcription factor 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_001013368.4-3068s1c1
Sequence:CCGGGAGCTATTTAATGAGACAATACTCGAGTATTGTCTCATTAAATAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_001013368.4-748s1c1
Sequence:CCGGCACTTATCAGGAGACGAATTTCTCGAGAAATTCGTCTCCTGATAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013368.4-2622s21c1
Sequence:CCGGCCCAAGCTCGGCTATCGTAAACTCGAGTTTACGATAGCCGAGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013368.4-1413s21c1
Sequence:CCGGCCTGAGTAGCTTGGATCTTATCTCGAGATAAGATCCAAGCTACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013368.4-904s21c1
Sequence:CCGGGTTGAACGTCGGCGGATTTATCTCGAGATAAATCCGCCGACGTTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013368.4-748s21c1
Sequence:CCGGCACTTATCAGGAGACGAATTTCTCGAGAAATTCGTCTCCTGATAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013368.4-3268s21c1
Sequence:CCGGTTCAGCCTTCAGTACTATAAACTCGAGTTTATAGTACTGAAGGCTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_001013368.2-1482s1c1
Sequence:CCGGGTCCCTCATCAAGTTGGTAAACTCGAGTTTACCAACTTGATGAGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013368.2-1620s1c1
Sequence:CCGGCGCTATTTGCAAGATGCAGTTCTCGAGAACTGCATCTTGCAAATAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_001013368.2-1158s1c1
Sequence:CCGGCCTGGAAATTGCTGCCAAGATCTCGAGATCTTGGCAGCAATTTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013368
VALIDATED
E2F8 MISSION shRNA shRNA Plasmid DNA
E2F transcription factor 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_001013368.4-3068s1c1
Sequence:CCGGGAGCTATTTAATGAGACAATACTCGAGTATTGTCTCATTAAATAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_001013368.4-748s1c1
Sequence:CCGGCACTTATCAGGAGACGAATTTCTCGAGAAATTCGTCTCCTGATAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013368.4-2622s21c1
Sequence:CCGGCCCAAGCTCGGCTATCGTAAACTCGAGTTTACGATAGCCGAGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013368.4-1413s21c1
Sequence:CCGGCCTGAGTAGCTTGGATCTTATCTCGAGATAAGATCCAAGCTACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013368.4-904s21c1
Sequence:CCGGGTTGAACGTCGGCGGATTTATCTCGAGATAAATCCGCCGACGTTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013368.4-748s21c1
Sequence:CCGGCACTTATCAGGAGACGAATTTCTCGAGAAATTCGTCTCCTGATAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013368.4-3268s21c1
Sequence:CCGGTTCAGCCTTCAGTACTATAAACTCGAGTTTATAGTACTGAAGGCTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_001013368.2-1482s1c1
Sequence:CCGGGTCCCTCATCAAGTTGGTAAACTCGAGTTTACCAACTTGATGAGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013368.2-1620s1c1
Sequence:CCGGCGCTATTTGCAAGATGCAGTTCTCGAGAACTGCATCTTGCAAATAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_001013368.2-1158s1c1
Sequence:CCGGCCTGGAAATTGCTGCCAAGATCTCGAGATCTTGGCAGCAATTTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013368
VALIDATED
E2F8 MISSION shRNA Lentiviral Transduction Particles
E2F transcription factor 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_001013368.4-3068s1c1
Sequence:CCGGGAGCTATTTAATGAGACAATACTCGAGTATTGTCTCATTAAATAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_001013368.4-748s1c1
Sequence:CCGGCACTTATCAGGAGACGAATTTCTCGAGAAATTCGTCTCCTGATAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013368.4-2622s21c1
Sequence:CCGGCCCAAGCTCGGCTATCGTAAACTCGAGTTTACGATAGCCGAGCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013368.4-1413s21c1
Sequence:CCGGCCTGAGTAGCTTGGATCTTATCTCGAGATAAGATCCAAGCTACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013368.4-904s21c1
Sequence:CCGGGTTGAACGTCGGCGGATTTATCTCGAGATAAATCCGCCGACGTTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013368.4-748s21c1
Sequence:CCGGCACTTATCAGGAGACGAATTTCTCGAGAAATTCGTCTCCTGATAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013368.4-3268s21c1
Sequence:CCGGTTCAGCCTTCAGTACTATAAACTCGAGTTTATAGTACTGAAGGCTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_001013368.2-1482s1c1
Sequence:CCGGGTCCCTCATCAAGTTGGTAAACTCGAGTTTACCAACTTGATGAGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013368.2-1620s1c1
Sequence:CCGGCGCTATTTGCAAGATGCAGTTCTCGAGAACTGCATCTTGCAAATAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_001013368.2-1158s1c1
Sequence:CCGGCCTGGAAATTGCTGCCAAGATCTCGAGATCTTGGCAGCAATTTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)