EED

embryonic ectoderm development

153 Gene Product Result for

Synonyms: HEED WAIT1

Species: Human EED(8726), Mouse Eed(13626), Rat Eed(293104), Zebrafish eed(550463), chicken EED(426381), dog EED(476779), cow EED(404183), domestic cat EED(101094696), naked mole-rat Eed(101705385), domestic guinea pig Eed(100728793), sheep EED(101113712)

UniProtKB ID: O75530, A8K7V5, O00149, Q6NTH2, Q7LDA5, Q7LDG8, Q86VV2, Q9UNY7

Gene ID:

Human(8726) Summary: This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein interacts with enhancer of zeste 2, the cytoplasmic tail of integrin beta7, immunodeficiency virus type 1 (HIV-1) MA protein, and histone deacetylase proteins. This protein mediates repression of gene activity through histone deacetylation, and may act as a specific regulator of integrin function. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

Mouse(13626) embryonic ectoderm development

Rat(293104) embryonic ectoderm development

Zebrafish(550463) embryonic ectoderm development

chicken(426381) embryonic ectoderm development

dog(476779) embryonic ectoderm development

cow(404183) embryonic ectoderm development

domestic cat(101094696) embryonic ectoderm development

naked mole-rat(101705385) embryonic ectoderm development

domestic guinea pig(100728793) embryonic ectoderm development

sheep(101113712) embryonic ectoderm development

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

SAB2108517	Anti-EED affinity isolated antibody	bovine, rat, human, horse, rabbit, dog, mouse, guinea pig	western blot	pricing

GW10896A	Anti-EED antibody produced in chicken affinity isolated antibody, buffered aqueous solution	mouse, rat, human	western blot	pricing

SAB1406713	Anti-EED antibody produced in mouse purified immunoglobulin, buffered aqueous solution	human	immunofluorescence, western blot	pricing

SAB2108394	Anti-EED antibody produced in rabbit affinity isolated antibody	horse, mouse, dog, guinea pig, human, rabbit, rat, bovine	western blot	pricing

HPA061140	Anti-EED antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunohistochemistry, western blot	pricing

SAB2106433	Anti-EED antibody produced in rabbit affinity isolated antibody	rat, mouse, human, horse, guinea pig, dog, bovine, rabbit	western blot	pricing

HPA060089	Anti-EED antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody	human	immunofluorescence, western blot	pricing

SAB2104969	Anti-EED, (N-terminal) antibody produced in rabbit affinity isolated antibody	mouse, dog, bovine, human, horse, guinea pig, rat	immunofluorescence, western blot	pricing

SAB2702185	Monoclonal Anti-EED antibody produced in mouse clone GT671, affinity isolated antibody	mouse, human, rat	western blot	pricing

SAB1403003	Monoclonal Anti-EED, (C-terminal) antibody produced in mouse clone 3B12, purified immunoglobulin, buffered aqueous solution	human	ELISA, western blot	pricing

Zinc Finger Nucleases

Product #	Description	Add to Cart

CKOZFN30440	CompoZr^® Knockout ZFN Kit Mouse Eed (NM_021876.3)	pricing

CKOZFN53315	CompoZr^® Knockout ZFN Kit Rat Eed (NM_001106278)	pricing

CKOZFN7661	CompoZr^® Knockout ZFN Kit Human EED (NM_003797)	pricing

CKOZFND30440	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Mouse Eed (NM_021876.3)	pricing

CKOZFND53315	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Rat Eed (NM_001106278)	pricing

CKOZFND7661	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Human EED (NM_003797)	pricing

Proteins

Product #	Description	Species	Add to Cart

SRP6583	EED (1-441) human recombinant, expressed in E. coli, ≥95% (SDS-PAGE)	human	pricing

SRP0168	EED human recombinant, expressed in baculovirus infected insect cells, ≥90% (SDS-PAGE)	human	pricing

SRP0380	EZH2 /EED/SUZ12/RbAp48/AEBP2 human recombinant, expressed in baculovirus infected Sf9 cells, ≥90% (SDS-PAGE)	human	pricing

SRP0381	EZH2 /EED/SUZ12/RbAp48/AEBP2 human recombinant, expressed in baculovirus infected Sf9 cells, ≥90% (SDS-PAGE)	human	pricing

SRP0382	EZH2 /EED/SUZ12/RbAp48/AEBP2 human recombinant, expressed in baculovirus infected Sf9 cells, ≥75% (SDS-PAGE)	human	pricing

SRP0387	EZH2 /EED/SUZ12/RbAp48/AEBP2 human recombinant, expressed in baculovirus infected Sf9 cells, ≥56% (SDS-PAGE)	human	pricing

SRP0388	EZH2 /EED/SUZ12/RbAp48/AEBP2 human recombinant, expressed in baculovirus infected Sf9 cells, ≥90% (SDS-PAGE)	human	pricing

SRP0394	EZH2/EED/SUZ12/RbAp48 active human recombinant, expressed in baculovirus infected Sf9 cells, ≥90% (SDS-PAGE)	human	pricing

APREST89899	PrEST Antigen EED Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

APREST87903	PrEST Antigen EED Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST21732	SILu^™PrEST EED SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

3'UTR GoClone

Product #	Description	Species	Add to Cart

HUTR06255	MISSION^® 3′UTR Lenti GoClone^™ Powered by SwitchGear Genomics^™, 3′UTR, human, EED	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_003797	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_003797	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_003797	MISSION® shRNA Lentiviral Transduction Particles	human	pricing
SHCLNG-NM_021876	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_021876	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_021876	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU062201	MISSION^® esiRNA esiRNA human EED (esiRNA1)	human	pricing

EMU178331	MISSION^® esiRNA esiRNA targeting mouse Eed	mouse	pricing

Related Products

Product #	Description	Add to Cart

17-10034	ChIPAb+ EED - ChIP Validated Antibody and Primer Set This ChIPAb+ EED -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers.	pricing

17-663	ChIPAb+ EED - ChIP Validated Antibody and Primer Set This ChIPAb+ EED -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers.	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_003797	Rosetta Predictions	human	pricing
NM_152991	Rosetta Predictions	human	pricing
NM_001106278	Rosetta Predictions	rat	pricing
NM_021876	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_003797	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs02_00336316 predicted	772
2	SASI_Hs02_00336317 predicted	1228
3	SASI_Hs01_00147052 predicted	751
4	SASI_Hs01_00147053 predicted	847
5	SASI_Hs01_00147054 predicted	1280
6	SASI_Hs01_00147055 predicted	1220
7	SASI_Hs01_00147056 predicted	571
8	SASI_Hs02_00336318 predicted	630
9	SASI_Hs01_00147057 predicted	560
10	SASI_Hs01_00147058 predicted	806
11	SASI_Hs01_00147059 predicted	768
12	SASI_Hs01_00147060 predicted	1220
13	SASI_Hs01_00147061 predicted	988

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_152991	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs02_00366940 predicted	781
2	SASI_Hs02_00366941 predicted	1223
3	SASI_Hs01_00201697 predicted	748
4	SASI_Hs01_00201698 predicted	846
5	SASI_Hs01_00201699 predicted	1286
6	SASI_Hs01_00201700 predicted	1217
7	SASI_Hs01_00201701 predicted	573
8	SASI_Hs02_00366942 predicted	628
9	SASI_Hs01_00201702 predicted	564
10	SASI_Hs01_00201703 predicted	811
11	SASI_Hs01_00201704 predicted	764
12	SASI_Hs01_00201705 predicted	1223
13	SASI_Hs01_00201706 predicted	997

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001106278	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00217398 predicted	1218
2	SASI_Rn02_00217399 predicted	819
3	SASI_Rn02_00217400 predicted	1468
4	SASI_Rn02_00217401 predicted	720
5	SASI_Rn02_00217402 predicted	1558
6	SASI_Rn02_00217403 predicted	949
7	SASI_Rn02_00217404 predicted	1619
8	SASI_Rn02_00217405 predicted	1686
9	SASI_Rn02_00217406 predicted	912
10	SASI_Rn02_00217407 predicted	1001

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_021876	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00050931 predicted	1493
2	SASI_Mm01_00050932 predicted	747
3	SASI_Mm01_00050934 predicted	836
4	SASI_Mm01_00050935 predicted	1585
5	SASI_Mm01_00050936 predicted	974
6	SASI_Mm01_00050937 predicted	1720
7	SASI_Mm01_00050938 predicted	800
8	SASI_Mm02_00326435 predicted	1816
9	SASI_Mm01_00050939 predicted	940
10	SASI_Mm01_00050940 predicted	1646
11	SASI_Mm01_00050933 predicted	850

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_003797 VALIDATED	EED MISSION shRNA Bacterial Glycerol Stock embryonic ectoderm development	Human

11 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000276496
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_003797.2-954s21c1
	Sequence:CCGGCTGGATCTAGAGGCATAATTACTCGAGTAATTATGCCTCTAGATCCAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000276442
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_003797.2-1834s21c1
	Sequence:CCGGAGAATTAATGTATCTTGCTAGCTCGAGCTAGCAAGATACATTAATTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000021204
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_003797.2-1608s1c1
	Sequence:CCGGGCAAACTTTATGTTTGGGATTCTCGAGAATCCCAAACATAAAGTTTGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000021205
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_003797.2-1359s1c1
	Sequence:CCGGCCAGAGACATACATAGGAATTCTCGAGAATTCCTATGTATGTCTCTGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000021208
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.86	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_003797.2-1491s1c1
	Sequence:CCGGCCAGTGAATCTAATGTGACTACTCGAGTAGTCACATTAGATTCACTGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000021206
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.72	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_003797.2-1722s1c1
	Sequence:CCGGGCAGCATTCTTATAGCTGTTTCTCGAGAAACAGCTATAAGAATGCTGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000021207
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003797.2-986s1c1
	Sequence:CCGGCCTATAACAATGCAGTGTATACTCGAGTATACACTGCATTGTTATAGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000276501
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_003797.2-1722s21c1
	Sequence:CCGGGCAGCATTCTTATAGCTGTTTCTCGAGAAACAGCTATAAGAATGCTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000276443
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_003797.2-1491s21c1
	Sequence:CCGGCCAGTGAATCTAATGTGACTACTCGAGTAGTCACATTAGATTCACTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000276441
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_003797.2-1359s21c1
	Sequence:CCGGCCAGAGACATACATAGGAATTCTCGAGAATTCCTATGTATGTCTCTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000381832
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_003797.2-1124s21c1
	Sequence:GTACCGGGACACTCTGGTGGCAATATTTCTCGAGAAATATTGCCACCAGAGTGTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_003797 VALIDATED	EED MISSION shRNA shRNA Plasmid DNA embryonic ectoderm development	Human

11 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000276496
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_003797.2-954s21c1
	Sequence:CCGGCTGGATCTAGAGGCATAATTACTCGAGTAATTATGCCTCTAGATCCAGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000276442
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_003797.2-1834s21c1
	Sequence:CCGGAGAATTAATGTATCTTGCTAGCTCGAGCTAGCAAGATACATTAATTCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000021204
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_003797.2-1608s1c1
	Sequence:CCGGGCAAACTTTATGTTTGGGATTCTCGAGAATCCCAAACATAAAGTTTGCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000021205
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_003797.2-1359s1c1
	Sequence:CCGGCCAGAGACATACATAGGAATTCTCGAGAATTCCTATGTATGTCTCTGGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000021208
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.86	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_003797.2-1491s1c1
	Sequence:CCGGCCAGTGAATCTAATGTGACTACTCGAGTAGTCACATTAGATTCACTGGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000021206
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.72	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_003797.2-1722s1c1
	Sequence:CCGGGCAGCATTCTTATAGCTGTTTCTCGAGAAACAGCTATAAGAATGCTGCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000021207
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003797.2-986s1c1
	Sequence:CCGGCCTATAACAATGCAGTGTATACTCGAGTATACACTGCATTGTTATAGGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000276501
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_003797.2-1722s21c1
	Sequence:CCGGGCAGCATTCTTATAGCTGTTTCTCGAGAAACAGCTATAAGAATGCTGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000276443
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_003797.2-1491s21c1
	Sequence:CCGGCCAGTGAATCTAATGTGACTACTCGAGTAGTCACATTAGATTCACTGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000276441
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_003797.2-1359s21c1
	Sequence:CCGGCCAGAGACATACATAGGAATTCTCGAGAATTCCTATGTATGTCTCTGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000381832
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_003797.2-1124s21c1
	Sequence:GTACCGGGACACTCTGGTGGCAATATTTCTCGAGAAATATTGCCACCAGAGTGTCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_003797 VALIDATED	EED MISSION shRNA Lentiviral Transduction Particles embryonic ectoderm development	Human

11 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000276496
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_003797.2-954s21c1
	Sequence:CCGGCTGGATCTAGAGGCATAATTACTCGAGTAATTATGCCTCTAGATCCAGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000276442
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_003797.2-1834s21c1
	Sequence:CCGGAGAATTAATGTATCTTGCTAGCTCGAGCTAGCAAGATACATTAATTCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000021204
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_003797.2-1608s1c1
	Sequence:CCGGGCAAACTTTATGTTTGGGATTCTCGAGAATCCCAAACATAAAGTTTGCTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000021205
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_003797.2-1359s1c1
	Sequence:CCGGCCAGAGACATACATAGGAATTCTCGAGAATTCCTATGTATGTCTCTGGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000021208
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.86	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_003797.2-1491s1c1
	Sequence:CCGGCCAGTGAATCTAATGTGACTACTCGAGTAGTCACATTAGATTCACTGGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000021206
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.72	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_003797.2-1722s1c1
	Sequence:CCGGGCAGCATTCTTATAGCTGTTTCTCGAGAAACAGCTATAAGAATGCTGCTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000021207
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_003797.2-986s1c1
	Sequence:CCGGCCTATAACAATGCAGTGTATACTCGAGTATACACTGCATTGTTATAGGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000276501
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_003797.2-1722s21c1
	Sequence:CCGGGCAGCATTCTTATAGCTGTTTCTCGAGAAACAGCTATAAGAATGCTGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000276443
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_003797.2-1491s21c1
	Sequence:CCGGCCAGTGAATCTAATGTGACTACTCGAGTAGTCACATTAGATTCACTGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000276441
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_003797.2-1359s21c1
	Sequence:CCGGCCAGAGACATACATAGGAATTCTCGAGAATTCCTATGTATGTCTCTGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000381832
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_003797.2-1124s21c1
	Sequence:GTACCGGGACACTCTGGTGGCAATATTTCTCGAGAAATATTGCCACCAGAGTGTCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_021876 VALIDATED	EED MISSION shRNA Bacterial Glycerol Stock embryonic ectoderm development	Mouse

8 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000095719
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.85	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_021876.1-1834s1c1
	Sequence:CCGGTCTTGCTAGTAAGGGCACATACTCGAGTATGTGCCCTTACTAGCAAGATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000095723
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_021876.1-1378s1c1
	Sequence:CCGGGTTGATTGTGTGCGATGGTTACTCGAGTAACCATCGCACACAATCAACTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000095722
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_021876.1-803s1c1
	Sequence:CCGGGAAGCAACAGAGTAACCTTATCTCGAGATAAGGTTACTCTGTTGCTTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000095720
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.76	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_021876.1-1685s1c1
	Sequence:CCGGCGGCTATTCGACAAACCAGTTCTCGAGAACTGGTTTGTCGAATAGCCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000095721
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_021876.1-1530s1c1
	Sequence:CCGGCCAGTGTGACATTTGGTACATCTCGAGATGTACCAAATGTCACACTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000438200
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_021876.3-614s21c1
	Sequence:CCGGACGCCCACAAATACGCCAAATCTCGAGATTTGGCGTATTTGTGGGCGTTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000437753
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_021876.3-1887s21c1
	Sequence:CCGGGCTGAGCTGAATGTAGTGATGCTCGAGCATCACTACATTCAGCTCAGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000425721
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_021876.3-921s21c1
	Sequence:CCGGACACCAGCCACCCTCTATTAGCTCGAGCTAATAGAGGGTGGCTGGTGTTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_021876 VALIDATED	EED MISSION shRNA shRNA Plasmid DNA embryonic ectoderm development	Mouse

8 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000095719
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.85	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_021876.1-1834s1c1
	Sequence:CCGGTCTTGCTAGTAAGGGCACATACTCGAGTATGTGCCCTTACTAGCAAGATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000095723
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_021876.1-1378s1c1
	Sequence:CCGGGTTGATTGTGTGCGATGGTTACTCGAGTAACCATCGCACACAATCAACTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000095722
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_021876.1-803s1c1
	Sequence:CCGGGAAGCAACAGAGTAACCTTATCTCGAGATAAGGTTACTCTGTTGCTTCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000095720
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.76	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_021876.1-1685s1c1
	Sequence:CCGGCGGCTATTCGACAAACCAGTTCTCGAGAACTGGTTTGTCGAATAGCCGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000095721
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_021876.1-1530s1c1
	Sequence:CCGGCCAGTGTGACATTTGGTACATCTCGAGATGTACCAAATGTCACACTGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000438200
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_021876.3-614s21c1
	Sequence:CCGGACGCCCACAAATACGCCAAATCTCGAGATTTGGCGTATTTGTGGGCGTTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000437753
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_021876.3-1887s21c1
	Sequence:CCGGGCTGAGCTGAATGTAGTGATGCTCGAGCATCACTACATTCAGCTCAGCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000425721
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_021876.3-921s21c1
	Sequence:CCGGACACCAGCCACCCTCTATTAGCTCGAGCTAATAGAGGGTGGCTGGTGTTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_021876 VALIDATED	EED MISSION shRNA Lentiviral Transduction Particles embryonic ectoderm development	Mouse

8 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000095719
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.85	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_021876.1-1834s1c1
	Sequence:CCGGTCTTGCTAGTAAGGGCACATACTCGAGTATGTGCCCTTACTAGCAAGATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000095723
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_021876.1-1378s1c1
	Sequence:CCGGGTTGATTGTGTGCGATGGTTACTCGAGTAACCATCGCACACAATCAACTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000095722
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_021876.1-803s1c1
	Sequence:CCGGGAAGCAACAGAGTAACCTTATCTCGAGATAAGGTTACTCTGTTGCTTCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000095720
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.76	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_021876.1-1685s1c1
	Sequence:CCGGCGGCTATTCGACAAACCAGTTCTCGAGAACTGGTTTGTCGAATAGCCGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000095721
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_021876.1-1530s1c1
	Sequence:CCGGCCAGTGTGACATTTGGTACATCTCGAGATGTACCAAATGTCACACTGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000438200
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_021876.3-614s21c1
	Sequence:CCGGACGCCCACAAATACGCCAAATCTCGAGATTTGGCGTATTTGTGGGCGTTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000437753
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_021876.3-1887s21c1
	Sequence:CCGGGCTGAGCTGAATGTAGTGATGCTCGAGCATCACTACATTCAGCTCAGCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000425721
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_021876.3-921s21c1
	Sequence:CCGGACACCAGCCACCCTCTATTAGCTCGAGCTAATAGAGGGTGGCTGGTGTTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart