EMAIL THIS PAGE TO A FRIEND

EFCAB13

EF-hand calcium binding domain 13

130 Gene Product Result for
Synonyms: C17orf57
UniProtKB ID: Q8IY85, G3V128, Q49AG9
Gene ID:
domestic cat(101092410) EF-hand calcium binding domain 13
cow(101908066) EF-hand calcium binding domain 13
sheep(101121530) EF-hand calcium binding domain 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152347 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152347 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152347 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084941 MISSION® esiRNA esiRNA human C17orf57 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152347 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071634 predicted 3001
2 SASI_Hs01_00071635 predicted 2701
3 SASI_Hs02_00365969 predicted 1714
4 SASI_Hs02_00365970 predicted 1598
5 SASI_Hs01_00071638 predicted 3134
6 SASI_Hs01_00071639 predicted 2034
7 SASI_Hs01_00071640 predicted 1267
8 SASI_Hs01_00071641 predicted 1040
9 SASI_Hs01_00071642 predicted 2805
10 SASI_Hs02_00365971 predicted 1146
11 SASI_Hs01_00071633 predicted 3216
12 SASI_Hs01_00071636 predicted 2317
13 SASI_Hs01_00071637 predicted 1394
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152347
EFCAB13 MISSION shRNA Bacterial Glycerol Stock
EF-hand calcium binding domain 13
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152347.3-1344s21c1
Sequence:CCGGTGTAGCAGGATGCTATCTAAACTCGAGTTTAGATAGCATCCTGCTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152347.3-2733s21c1
Sequence:CCGGCAAGATTGGTATACCTGATTTCTCGAGAAATCAGGTATACCAATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152347.3-3597s21c1
Sequence:CCGGTGTAATGTAACCCTTACTATACTCGAGTATAGTAAGGGTTACATTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152347.3-1217s21c1
Sequence:CCGGGTAACCACATGGTGGATATTGCTCGAGCAATATCCACCATGTGGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152347.3-3203s1c1
Sequence:CCGGCGATAGTTAAAGCACAGGTAACTCGAGTTACCTGTGCTTTAACTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152347.3-2677s1c1
Sequence:CCGGCCAAAGGTAAACGAGATTAAACTCGAGTTTAATCTCGTTTACCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152347.3-2701s1c1
Sequence:CCGGGCTGCTAACATCTTGTCACATCTCGAGATGTGACAAGATGTTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152347.3-897s1c1
Sequence:CCGGCCATGGATATTTACACTCAAACTCGAGTTTGAGTGTAAATATCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152347.3-1558s1c1
Sequence:CCGGCCATATTCAAAGAATGGCATACTCGAGTATGCCATTCTTTGAATATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152347
EFCAB13 MISSION shRNA shRNA Plasmid DNA
EF-hand calcium binding domain 13
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152347.3-1344s21c1
Sequence:CCGGTGTAGCAGGATGCTATCTAAACTCGAGTTTAGATAGCATCCTGCTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152347.3-2733s21c1
Sequence:CCGGCAAGATTGGTATACCTGATTTCTCGAGAAATCAGGTATACCAATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152347.3-3597s21c1
Sequence:CCGGTGTAATGTAACCCTTACTATACTCGAGTATAGTAAGGGTTACATTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152347.3-1217s21c1
Sequence:CCGGGTAACCACATGGTGGATATTGCTCGAGCAATATCCACCATGTGGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152347.3-3203s1c1
Sequence:CCGGCGATAGTTAAAGCACAGGTAACTCGAGTTACCTGTGCTTTAACTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152347.3-2677s1c1
Sequence:CCGGCCAAAGGTAAACGAGATTAAACTCGAGTTTAATCTCGTTTACCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152347.3-2701s1c1
Sequence:CCGGGCTGCTAACATCTTGTCACATCTCGAGATGTGACAAGATGTTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152347.3-897s1c1
Sequence:CCGGCCATGGATATTTACACTCAAACTCGAGTTTGAGTGTAAATATCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152347.3-1558s1c1
Sequence:CCGGCCATATTCAAAGAATGGCATACTCGAGTATGCCATTCTTTGAATATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152347
EFCAB13 MISSION shRNA Lentiviral Transduction Particles
EF-hand calcium binding domain 13
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152347.3-1344s21c1
Sequence:CCGGTGTAGCAGGATGCTATCTAAACTCGAGTTTAGATAGCATCCTGCTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152347.3-2733s21c1
Sequence:CCGGCAAGATTGGTATACCTGATTTCTCGAGAAATCAGGTATACCAATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152347.3-3597s21c1
Sequence:CCGGTGTAATGTAACCCTTACTATACTCGAGTATAGTAAGGGTTACATTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152347.3-1217s21c1
Sequence:CCGGGTAACCACATGGTGGATATTGCTCGAGCAATATCCACCATGTGGTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152347.3-3203s1c1
Sequence:CCGGCGATAGTTAAAGCACAGGTAACTCGAGTTACCTGTGCTTTAACTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152347.3-2677s1c1
Sequence:CCGGCCAAAGGTAAACGAGATTAAACTCGAGTTTAATCTCGTTTACCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152347.3-2701s1c1
Sequence:CCGGGCTGCTAACATCTTGTCACATCTCGAGATGTGACAAGATGTTAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152347.3-897s1c1
Sequence:CCGGCCATGGATATTTACACTCAAACTCGAGTTTGAGTGTAAATATCCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152347.3-1558s1c1
Sequence:CCGGCCATATTCAAAGAATGGCATACTCGAGTATGCCATTCTTTGAATATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)