EGFR

epidermal growth factor receptor

214 Gene Product Result for

Synonyms: ERBB ERBB1 HER1 PIG61 mENA

Species: Human EGFR(1956), Mouse Egfr(13649), Rat Egfr(24329), fruit fly Egfr(37455), cow EGFR(407217), Horse EGFR(100067755), domestic cat EGFR(100510799), dog EGFR(404306), chicken EGFR(396494), domestic guinea pig Egfr(100725363), naked mole-rat Egfr(101723771), sheep EGFR(780479)

UniProtKB ID: P00533, O00688, O00732, P06268, Q14225, Q68GS5, Q92795, Q9BZS2

Gene ID:

Human(1956) Summary: The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. Multiple alternatively spliced transcript variants that encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2010]

Mouse(13649) epidermal growth factor receptor

Rat(24329) epidermal growth factor receptor

fruit fly(37455) Epidermal growth factor receptor

cow(407217) epidermal growth factor receptor

Horse(100067755) epidermal growth factor receptor

domestic cat(100510799) epidermal growth factor receptor

dog(404306) epidermal growth factor receptor

chicken(396494) epidermal growth factor receptor

domestic guinea pig(100725363) epidermal growth factor receptor

naked mole-rat(101723771) epidermal growth factor receptor

sheep(780479) epidermal growth factor receptor

Gene Class: Apoptosis, Cell_Adhesion

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

E2906	Anti-dEGF Receptor, Extracellular Domain antibody, Mouse monoclonal clone C-273, purified from hybridoma cell culture	Drosophila	ELISA, immunohistochemistry, western blot	pricing

SAB4300352	Anti-EGFR (Ab-1070) antibody produced in rabbit affinity isolated antibody	human	immunofluorescence, immunohistochemistry, western blot	pricing

SAB4300353	Anti-EGFR (Ab-1092) antibody produced in rabbit affinity isolated antibody	rat, human	immunohistochemistry, western blot	pricing

SAB4300510	Anti-EGFR (Ab-1110) antibody produced in rabbit affinity isolated antibody	human	immunohistochemistry, western blot	pricing

SAB4300472	Anti-EGFR (Ab-1172) antibody produced in rabbit affinity isolated antibody	human, rat, mouse	western blot	pricing

SAB4300602	Anti-EGFR (Ab-1197) antibody produced in goat affinity isolated antibody	mouse, human, rat	western blot	pricing

SAB4300454	Anti-EGFR (Ab-693) antibody produced in rabbit affinity isolated antibody	mouse, human, rat	western blot	pricing

GW21146	Anti-EGFR antibody produced in chicken affinity isolated antibody, buffered aqueous solution	rat, human, mouse	western blot	pricing

SAB1405746	Anti-EGFR antibody produced in mouse purified immunoglobulin, buffered aqueous solution	human	immunofluorescence, proximity ligation assay, western blot	pricing

HPA001200	Anti-EGFR antibody produced in rabbit Ab1, Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunohistochemistry	pricing

HPA018530	Anti-EGFR antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human, rat, mouse	immunofluorescence, immunohistochemistry, western blot	pricing

SAB4500711	Anti-EGFR antibody produced in rabbit affinity isolated antibody	mouse, human, rat	ELISA, immunohistochemistry, western blot	pricing

SAB4500712	Anti-EGFR antibody produced in rabbit affinity isolated antibody	human, mouse, rat	ELISA, immunofluorescence, immunohistochemistry, western blot	pricing

SAB4500713	Anti-EGFR antibody produced in rabbit affinity isolated antibody	mouse, rat, human	ELISA, immunofluorescence, immunohistochemistry, western blot	pricing

SAB4500714	Anti-EGFR antibody produced in rabbit affinity isolated antibody	rat, human, mouse	ELISA, western blot	pricing

SAB4500715	Anti-EGFR antibody produced in rabbit affinity isolated antibody	rat, mouse, human	ELISA, immunohistochemistry, western blot	pricing

SAB4500718	Anti-EGFR antibody produced in rabbit affinity isolated antibody	rat, mouse, human	ELISA, immunohistochemistry, western blot	pricing

SAB4500721	Anti-EGFR antibody produced in rabbit affinity isolated antibody	rat, mouse, human	ELISA, western blot	pricing

SAB4500722	Anti-EGFR antibody produced in rabbit affinity isolated antibody	rat, human, mouse	ELISA, western blot	pricing

SAB4500723	Anti-EGFR antibody produced in rabbit affinity isolated antibody	mouse, rat, human	ELISA, western blot	pricing

ZRB04338	Anti-EGFR Antibody, clone 11E19, ZooMAb^® Rabbit Monoclonal recombinant monoclonal antibody	human, mouse	gene knockdown, immunocytochemistry, immunohistochemistry, western blot	pricing

SAB5500096	Anti-EGFR antibody, Rabbit monoclonal clone SP84, recombinant, expressed in proprietary host, affinity isolated antibody	human (tested)	immunohistochemistry, western blot	pricing

SAB5500097	Anti-EGFR antibody, Rabbit monoclonal clone SP9, recombinant, expressed in proprietary host, tissue culture supernatant	human (tested)	flow cytometry, immunohistochemistry	pricing

SAB4200802	Anti-Epidermal Growth Factor (EGF) Receptor antibody, Mouse monoclonal clone F4, purified from hybridoma cell culture	human	immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot	pricing

E1282	Anti-Epidermal Growth Factor Receptor antibody produced in goat affinity isolated antibody, lyophilized powder	mouse	immunohistochemistry, western blot	pricing

A204	Anti-Epidermal Growth Factor Receptor antibody produced in sheep IgG fraction of antiserum, buffered aqueous solution	dog, chicken, rat, human	immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot	pricing

E1157	Anti-Epidermal Growth Factor Receptor/Erb B1 antibody produced in goat affinity isolated antibody, lyophilized powder	human	ELISA, flow cytometry, immunoprecipitation (IP), western blot	pricing

SAB4504579	Anti-phospho-EGFR (pSer¹⁰²⁶) antibody produced in rabbit affinity isolated antibody	human, rat, mouse	ELISA, western blot	pricing

SAB4504382	Anti-phospho-EGFR (pSer¹⁰⁷⁰) antibody produced in rabbit affinity isolated antibody	human, mouse, rat	ELISA, immunohistochemistry, western blot	pricing

SAB4504580	Anti-phospho-EGFR (pSer¹⁰⁷¹) antibody produced in rabbit affinity isolated antibody	mouse, rat, human	ELISA, western blot	pricing

SAB4504578	Anti-phospho-EGFR (pSer⁶⁹⁵) antibody produced in rabbit affinity isolated antibody	mouse, human, rat	ELISA, western blot	pricing

SAB4300151	Anti-phospho-EGFR (pThr⁶⁷⁸) antibody produced in rabbit affinity isolated antibody	mouse, rat, human	western blot	pricing

SAB4503759	Anti-phospho-EGFR (pThr⁶⁷⁸) antibody produced in rabbit affinity isolated antibody	human, mouse, rat	ELISA, immunofluorescence, western blot	pricing

SAB4300152	Anti-phospho-EGFR (pThr⁶⁹³) antibody produced in rabbit affinity isolated antibody	rat, mouse, human	western blot	pricing

SAB4503909	Anti-phospho-EGFR (pTyr¹⁰¹⁶) antibody produced in rabbit affinity isolated antibody	rat, mouse, human	ELISA, immunofluorescence, immunohistochemistry, western blot	pricing

SAB4504170	Anti-phospho-EGFR (pTyr¹⁰⁶⁹) antibody produced in rabbit affinity isolated antibody	human, rat, mouse	ELISA, western blot	pricing

SAB4300063	Anti-phospho-EGFR (pTyr¹⁰⁹²) antibody produced in rabbit affinity isolated antibody	rat, human	immunohistochemistry, western blot	pricing

SAB4504383	Anti-phospho-EGFR (pTyr¹⁰⁹²) antibody produced in rabbit affinity isolated antibody	rat, human, mouse	ELISA, immunohistochemistry, western blot	pricing

SAB4300209	Anti-phospho-EGFR (pTyr¹¹¹⁰) antibody produced in rabbit affinity isolated antibody	human, rat, mouse	western blot	pricing

SAB4504384	Anti-phospho-EGFR (pTyr¹¹¹⁰) antibody produced in rabbit affinity isolated antibody	mouse, rat, human	ELISA, western blot	pricing

SAB4300177	Anti-phospho-EGFR (pTyr¹¹⁷²) antibody produced in rabbit affinity isolated antibody	human, mouse, rat	immunohistochemistry, western blot	pricing

SAB4504385	Anti-phospho-EGFR (pTyr¹¹⁷²) antibody produced in rabbit affinity isolated antibody	human, rat, mouse	ELISA, western blot	pricing

SAB4300285	Anti-phospho-EGFR (pTyr¹¹⁹⁷) antibody produced in goat affinity isolated antibody	mouse, human, rat	western blot	pricing

SAB4300183	Anti-phospho-EGFR (pTyr¹¹⁹⁷) antibody produced in rabbit affinity isolated antibody	rat, mouse, human	immunohistochemistry, western blot	pricing

SAB4504386	Anti-phospho-EGFR (pTyr¹¹⁹⁷) antibody produced in rabbit affinity isolated antibody	rat, human, mouse	ELISA, immunohistochemistry, western blot	pricing

SAB4300184	Anti-phospho-EGFR (pTyr⁸⁶⁹) antibody produced in rabbit affinity isolated antibody	human, rat, mouse	western blot	pricing

SAB4504387	Anti-phospho-EGFR (pTyr⁸⁶⁹) antibody produced in rabbit affinity isolated antibody	rat, human, mouse	ELISA, western blot	pricing

E6154	Anti-phospho-Epidermal Growth Factor Receptor (pTyr¹⁰⁶⁸) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution	human, rat	western blot	pricing

E1530	Anti-phospho-Epidermal Growth Factor Receptor (pTyr¹⁰⁸⁶) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution	human, mouse, rat	western blot	pricing

E6279	Anti-phospho-Epidermal Growth Factor Receptor (pTyr¹¹⁷³) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution	mouse, human, rat, chicken	western blot	pricing

E6029	Anti-phospho-Epidermal Growth Factor Receptor (pTyr⁸⁴⁵) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution	mouse, human, rat	immunocytochemistry, western blot	pricing

E0907	Anti-phospho-Epidermal Growth Factor Receptor (pTyr⁸⁴⁵) antibody produced in rabbit affinity isolated antibody, lyophilized powder	human	flow cytometry, immunohistochemistry, western blot	pricing

E1780	Anti-phospho-Epidermal Growth Factor Receptor (pTyr⁹⁹²) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution	human, rat (predicted), mouse (predicted), chicken (predicted)	western blot	pricing

E1655	Anti-phospho-Epidermal Growth Factor Receptor [pTyr¹¹⁴⁸] antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution	human	western blot	pricing

E3031	Monoclonal Anti-dEGF Receptor, Cytoplasmic Domain antibody produced in mouse ~1.5 mg/mL, clone E-257, purified immunoglobulin, buffered aqueous solution	Drosophila	ELISA, immunohistochemistry, western blot	pricing

E2156	Monoclonal Anti-EGF Receptor antibody produced in mouse clone 225, purified from hybridoma cell culture	human	immunoprecipitation (IP)	pricing

SAB4700845	Monoclonal Anti-EGFR (PhosphoTyr1173) antibody produced in mouse clone EM-13	human	western blot	pricing

SAB4700844	Monoclonal Anti-EGFR (PhosphoTyr992) antibody produced in mouse clone EM-12	human	western blot	pricing

WH0001956M2	Monoclonal Anti-EGFR antibody produced in mouse clone 4H2, purified immunoglobulin, buffered aqueous solution	human	ELISA	pricing

AMAB90816	Monoclonal Anti-EGFR antibody produced in mouse Prestige Antibodies^® Powered by Atlas Antibodies, clone CL0815, purified immunoglobulin, buffered aqueous glycerol solution	human	immunohistochemistry, western blot	pricing

AMAB90819	Monoclonal Anti-EGFR antibody produced in mouse Prestige Antibodies^® Powered by Atlas Antibodies, clone CL0822, purified immunoglobulin, buffered aqueous glycerol solution	human	western blot	pricing

SAB4700866	Monoclonal Anti-EGFR antibody produced in mouse clone EGFR1	human, horse	flow cytometry	pricing

E2760	Monoclonal Anti-Epidermal Growth Factor Receptor antibody produced in mouse clone 29.1, ascites fluid	canine, rat, human, pig, mouse	ELISA, western blot	pricing

E3138	Monoclonal Anti-Epidermal Growth Factor Receptor antibody produced in mouse clone F4, ascites fluid	human	ELISA, immunohistochemistry, immunoprecipitation (IP), microarray, western blot	pricing

E0532	Monoclonal Anti-Epidermal Growth Factor Receptor antibody produced in mouse clone 102618, purified immunoglobulin, lyophilized powder	human	western blot	pricing

E0782	Monoclonal Anti-Epidermal Growth Factor Receptor antibody produced in rat clone 176436, purified immunoglobulin, lyophilized powder	mouse	flow cytometry, western blot	pricing

E0657	Monoclonal Anti-phospho-Epidermal Growth Factor Receptor (pTyr¹⁰⁶⁸) antibody produced in mouse clone 338324, purified immunoglobulin, lyophilized powder	human	flow cytometry, western blot	pricing

PLA0101	Rabbit anti-EGFR Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc.	mouse, human	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

Small Molecule - Inhibitor

Product #	Description	Species	Add to Cart

186341	1-Naphthalenesulfonic acid >50%	human	pricing

N5602	1-Naphthyl phosphate 99%	human	pricing

249548	2-Naphthalenesulfonic acid technical grade, 70%	human	pricing

C7866	CGP-53353 solid	human	pricing

D3943	DAPH ≥98% (HPLC), solid	human	pricing

G0668	GW2974 ≥98% (HPLC), solid	human	pricing

L1289	Lavendustin C ≥97%, solid	human	pricing

361917	trans-4-Hydroxy-3-methoxy-β-nitrostyrene 98%	human	pricing

639729	trans-4-Hydroxy-β-nitrostyrene 97%	human	pricing

T7040	Tyrphostin 1 ≥98%	human	pricing

T7665	Tyrphostin 51 ≥98%	human	pricing

T3434	Tyrphostin AG 490 solid	human	pricing

T4568	Tyrphostin AG 528 ~90%	human	pricing

S8442	SU 5416 ≥98% (HPLC)	human, mouse	pricing

T182	Tyrphostin A9 solid	human, mouse	pricing

T4182	Tyrphostin AG 1478 ≥98%	human, mouse	pricing

T5318	Tyrphostin AG 808 ≥98%	human, mouse	pricing

G6649	Genistein synthetic, ≥98% (HPLC), powder	human, mouse, rat	pricing

G6776	Genistein from Glycine max (soybean), ~98% (HPLC)	human, mouse, rat	pricing

B3306	Bisindolylmaleimide IV ≥98% (TLC), solid	human, rat	pricing

Cell Lines

Product #	Description	Species	Add to Cart

CLL1097	A549 CELLS EGFR BIOSENSOR	human	pricing

CLL1141	A549 Cells GFP-EGFR	human	pricing

CLL1143	SKOV3 Cells GFP-HER2 RFP-EGFR	human	pricing

Proteins

Product #	Description	Species	Add to Cart

SRP3028	EGF-receptor human recombinant, expressed in CHO cells, ≥95% (SDS-PAGE), ≥95% (HPLC), cell culture tested	human	pricing

SRP5023	EGFR (695-end), active, GST tagged human PRECISIO^® Kinase, recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE), buffered aqueous glycerol solution	human	pricing

SRP0240	EGFR (L858R) Active human recombinant, expressed in baculovirus infected insect cells, ≥70% (SDS-PAGE)	human	pricing

SRP5325	EGFR (L861Q), active, GST tagged human PRECISIO^®, recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE), buffered aqueous glycerol solution	human	pricing

SRP0242	EGFR (T790M L858R) Active human recombinant, expressed in baculovirus infected insect cells, ≥70% (SDS-PAGE)	human	pricing

SRP0241	EGFR (T790M) Active human recombinant, expressed in baculovirus infected insect cells, ≥70% (SDS-PAGE)	human	pricing

SRP0239	EGFR Active human recombinant, expressed in baculovirus infected insect cells, ≥70% (SDS-PAGE)	human	pricing

SRP6404	EGFR/ErbB1 human recombinant, expressed in HEK 293 cells, ≥95% (SDS-PAGE)	human	pricing

E3641	Epidermal Growth Factor Receptor human buffered aqueous glycerol solution, 5,000-30,000 units/mg protein (Lowry)	human	pricing

E2645	Epidermal Growth Factor Receptor human lyophilized powder, ≥15,000 units/mg protein (Bradford)	human	pricing

APREST78873	PrEST Antigen EGFR Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

APREST78874	PrEST Antigen EGFR Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST22429	SILu^™PrEST EGFR SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST22430	SILu^™PrEST EGFR SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

SRP0344	EGFR active mouse recombinant, expressed in baculovirus infected Sf9 cells	mouse	pricing

SRP6409	ErbB1/EGFR from mouse recombinant, expressed in HEK 293 cells, ≥95% (SDS-PAGE)	mouse	pricing

ELISA

Product #	Description	Species	Add to Cart

CS0080	Epidermal Growth Factor Receptor ELISA human sufficient for 96 tests	human	pricing

RAB0941	Phosphotyrosine EGFR / Epidermal Growth Factor Receptor ELISA Kit	human	pricing

RAB1853	Mouse EGFR ELISA for serum, plasma and cell culture supernatants	mouse	pricing

AQUA Peptides

Product #	Description	Species	Add to Cart

AQ0094	AQUA^™ Peptide GSTAENAE(pY)L[R]	human	pricing

AQ0731	AQUA^™ Peptide NYVVTDHGSCV[R]	human, mouse, rat	pricing

3'UTR GoClone

Product #	Description	Species	Add to Cart

HUTR10032	MISSION^® 3′UTR Lenti GoClone^™ Powered by SwitchGear Genomics^™, 3′UTR, human, EGFR	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_207655	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_207655	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_207655	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing
SHCLNG-NM_005228	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_005228	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_005228	MISSION® shRNA Lentiviral Transduction Particles	human	pricing
SHCLNG-NM_007912	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_007912	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_007912	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU076761	MISSION^® esiRNA esiRNA human EGFR (esiRNA1)	human	pricing

EMU075311	MISSION^® esiRNA esiRNA targeting mouse Egfr (esiRNA1)	mouse	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_005228	Rosetta Predictions	human	pricing
NM_201282	Rosetta Predictions	human	pricing
NM_201283	Rosetta Predictions	human	pricing
NM_201284	Rosetta Predictions	human	pricing
NM_031507	Rosetta Predictions	rat	pricing
NM_007912	Rosetta Predictions	mouse	pricing
NM_207655	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_005228	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00215449 predicted	567
2	SASI_Hs01_00215450 predicted	444
3	SASI_Hs01_00215451 predicted	734
4	SASI_Hs01_00215452 predicted	462
5	SASI_Hs01_00215453 predicted	720
6	SASI_Hs01_00215454 predicted	645
7	SASI_Hs01_00215455 predicted	1097
8	SASI_Hs01_00215456 predicted	646
9	SASI_Hs02_00339216 predicted	1058
10	SASI_Hs02_00339217 predicted	1056
11	SASI_Hs01_00215447 predicted	646
12	SASI_Hs01_00215448 predicted	532

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_201282	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00010279 predicted	568
2	SASI_Hs01_00010280 predicted	445
3	SASI_Hs01_00010281 predicted	735
4	SASI_Hs01_00010282 predicted	467
5	SASI_Hs01_00010283 predicted	719
6	SASI_Hs01_00010284 predicted	644
7	SASI_Hs01_00010285 predicted	1096
8	SASI_Hs01_00010286 predicted	647
9	SASI_Hs02_00372918 predicted	1064
10	SASI_Hs02_00372919 predicted	1063
11	SASI_Hs01_00010277 predicted	646
12	SASI_Hs01_00010278 predicted	530

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_201283	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00084812 predicted	563
2	SASI_Hs01_00084813 predicted	444
3	SASI_Hs01_00084814 predicted	734
4	SASI_Hs01_00084815 predicted	463
5	SASI_Hs01_00084816 predicted	720
6	SASI_Hs01_00084817 predicted	651
7	SASI_Hs01_00084818 predicted	1095
8	SASI_Hs01_00084819 predicted	649
9	SASI_Hs02_00372920 predicted	1062
10	SASI_Hs02_00372921 predicted	1062
11	SASI_Hs01_00084810 predicted	641
12	SASI_Hs01_00084811 predicted	531

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_201284	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00115270 predicted	567
2	SASI_Hs01_00115271 predicted	449
3	SASI_Hs01_00115272 predicted	734
4	SASI_Hs01_00115273 predicted	459
5	SASI_Hs01_00115274 predicted	727
6	SASI_Hs01_00115275 predicted	645
7	SASI_Hs01_00115276 predicted	1093
8	SASI_Hs01_00115277 predicted	646
9	SASI_Hs02_00372922 predicted	1065
10	SASI_Hs02_00372923 predicted	1062
11	SASI_Hs01_00115268 predicted	639
12	SASI_Hs01_00115269 predicted	525

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_031507	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn01_00081670 predicted	2813
2	SASI_Rn01_00081671 predicted	914
3	SASI_Rn01_00081672 predicted	1549
4	SASI_Rn01_00081673 predicted	227
5	SASI_Rn01_00081674 predicted	556
6	SASI_Rn01_00081675 predicted	1149
7	SASI_Rn02_00264632 predicted	1884
8	SASI_Rn01_00081676 predicted	2964
9	SASI_Rn01_00081678 predicted	3345
10	SASI_Rn01_00081679 predicted	512
11	SASI_Rn01_00081677 predicted	1207

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_007912	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00101666 predicted	1097
2	SASI_Mm01_00101668 predicted	1531
3	SASI_Mm01_00101669 predicted	656
4	SASI_Mm01_00101671 predicted	1284
5	SASI_Mm01_00101672 predicted	356
6	SASI_Mm02_00312723 predicted	536
7	SASI_Mm01_00101673 predicted	371
8	SASI_Mm01_00101674 predicted	1275
9	SASI_Mm01_00101675 predicted	1161
10	SASI_Mm02_00312724 predicted	1330
11	SASI_Mm01_00101667 predicted	1660
12	SASI_Mm01_00101670 predicted	1678

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_207655	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00156603 predicted	1094
2	SASI_Mm01_00156605 predicted	1532
3	SASI_Mm01_00156606 predicted	659
4	SASI_Mm01_00156608 predicted	1279
5	SASI_Mm01_00156609 predicted	358
6	SASI_Mm02_00352175 predicted	535
7	SASI_Mm01_00156610 predicted	378
8	SASI_Mm01_00156611 predicted	1278
9	SASI_Mm01_00156612 predicted	1168
10	SASI_Mm02_00352176 predicted	1336
11	SASI_Mm01_00156604 predicted	1665
12	SASI_Mm01_00156607 predicted	1678

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_207655	EGFR MISSION shRNA Bacterial Glycerol Stock epidermal growth factor receptor	Mouse

9 Products Total

TRC Number
We do not support the configuration options you have chosen
TRCN0000055219
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_207655.1-2117s1c1
	Sequence:CCGGGCCAATAATGTCTGCCACCTACTCGAGTAGGTGGCAGACATTATTGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055222
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_207655.1-1296s1c1
	Sequence:CCGGGCATAGGCATTGGTGAATTTACTCGAGTAAATTCACCAATGCCTATGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055220
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_207655.1-3822s1c1
	Sequence:CCGGCCAAGCCAAATGGCATATTTACTCGAGTAAATATGCCATTTGGCTTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055218
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_207655.1-3135s1c1
	Sequence:CCGGGCTGGATGATAGATGCTGATACTCGAGTATCAGCATCTATCATCCAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055221
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_207655.1-2914s1c1
	Sequence:CCGGGCCTATCAAGTGGATGGCTTTCTCGAGAAAGCCATCCACTTGATAGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000348190
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_207655.2-1694s21c1
	Sequence:CCGGGCAAACACAATAAACTGGAAACTCGAGTTTCCAGTTTATTGTGTTTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000348123
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_207655.2-1535s21c1
	Sequence:CCGGGCTTTCGAGAACCTAGAAATACTCGAGTATTTCTAGGTTCTCGAAAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000334115
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_207655.2-3135s21c1
	Sequence:CCGGGCTGGATGATAGATGCTGATACTCGAGTATCAGCATCTATCATCCAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000334048
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_207655.2-3822s21c1
	Sequence:CCGGCCAAGCCAAATGGCATATTTACTCGAGTAAATATGCCATTTGGCTTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_207655	EGFR MISSION shRNA shRNA Plasmid DNA epidermal growth factor receptor	Mouse

9 Products Total

TRC Number		Vector
We do not support the configuration options you have chosen
TRCN0000055219
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_207655.1-2117s1c1
	Sequence:CCGGGCCAATAATGTCTGCCACCTACTCGAGTAGGTGGCAGACATTATTGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055222
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_207655.1-1296s1c1
	Sequence:CCGGGCATAGGCATTGGTGAATTTACTCGAGTAAATTCACCAATGCCTATGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055220
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_207655.1-3822s1c1
	Sequence:CCGGCCAAGCCAAATGGCATATTTACTCGAGTAAATATGCCATTTGGCTTGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055218
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_207655.1-3135s1c1
	Sequence:CCGGGCTGGATGATAGATGCTGATACTCGAGTATCAGCATCTATCATCCAGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055221
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_207655.1-2914s1c1
	Sequence:CCGGGCCTATCAAGTGGATGGCTTTCTCGAGAAAGCCATCCACTTGATAGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000348190
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_207655.2-1694s21c1
	Sequence:CCGGGCAAACACAATAAACTGGAAACTCGAGTTTCCAGTTTATTGTGTTTGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000348123
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_207655.2-1535s21c1
	Sequence:CCGGGCTTTCGAGAACCTAGAAATACTCGAGTATTTCTAGGTTCTCGAAAGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000334115
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_207655.2-3135s21c1
	Sequence:CCGGGCTGGATGATAGATGCTGATACTCGAGTATCAGCATCTATCATCCAGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000334048
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_207655.2-3822s21c1
	Sequence:CCGGCCAAGCCAAATGGCATATTTACTCGAGTAAATATGCCATTTGGCTTGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_207655	EGFR MISSION shRNA Lentiviral Transduction Particles epidermal growth factor receptor	Mouse

9 Products Total

TRC Number	Volume	Vector
We do not support the configuration options you have chosen
TRCN0000055219
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_207655.1-2117s1c1
	Sequence:CCGGGCCAATAATGTCTGCCACCTACTCGAGTAGGTGGCAGACATTATTGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055222
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_207655.1-1296s1c1
	Sequence:CCGGGCATAGGCATTGGTGAATTTACTCGAGTAAATTCACCAATGCCTATGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055220
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_207655.1-3822s1c1
	Sequence:CCGGCCAAGCCAAATGGCATATTTACTCGAGTAAATATGCCATTTGGCTTGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055218
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_207655.1-3135s1c1
	Sequence:CCGGGCTGGATGATAGATGCTGATACTCGAGTATCAGCATCTATCATCCAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055221
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_207655.1-2914s1c1
	Sequence:CCGGGCCTATCAAGTGGATGGCTTTCTCGAGAAAGCCATCCACTTGATAGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000348190
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_207655.2-1694s21c1
	Sequence:CCGGGCAAACACAATAAACTGGAAACTCGAGTTTCCAGTTTATTGTGTTTGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000348123
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_207655.2-1535s21c1
	Sequence:CCGGGCTTTCGAGAACCTAGAAATACTCGAGTATTTCTAGGTTCTCGAAAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000334115
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_207655.2-3135s21c1
	Sequence:CCGGGCTGGATGATAGATGCTGATACTCGAGTATCAGCATCTATCATCCAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000334048
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_207655.2-3822s21c1
	Sequence:CCGGCCAAGCCAAATGGCATATTTACTCGAGTAAATATGCCATTTGGCTTGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_005228 VALIDATED	EGFR MISSION shRNA Bacterial Glycerol Stock epidermal growth factor receptor	Human

31 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000039636
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005228.3-1216s1c1
	Sequence:CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039633
Product Details Validated	Region:UNK	Mean KnockDown Level: 0.75	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-4682s1c1
	Sequence:CCGGGCTGAGAATGTGGAATACCTACTCGAGTAGGTATTCCACATTCTCAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039635
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.58	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-2467s1c1
	Sequence:CCGGCCCGTCGCTATCAAGGAATTACTCGAGTAATTCCTTGATAGCGACGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195303
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.75	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.x-1166s1c1
	Sequence:CCGGCGCAAAGTGTGTAACGGAATACTCGAGTATTCCGTTACACACTTTGCGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000010329
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.9	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.x-4705s1c1
	Sequence:CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039634
Product Details Validated	Region:	Mean KnockDown Level: 0.87	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-3095s1c1
	Sequence:CCGGGCTGGATGATAGACGCAGATACTCGAGTATCTGCGTCTATCATCCAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121327
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_005228.3-5399s1c1
	Sequence:CCGGCCCATCCAATTTATCAAGGAACTCGAGTTCCTTGATAAATTGGATGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121067
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.82	Cell Line: A-431
	TRC Version: 1	Clone ID:NM_005228.3-4888s1c1
	Sequence:CCGGGCTGCTCTGAAATCTCCTTTACTCGAGTAAAGGAGATTTCAGAGCAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121071
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005228.3-3383s1c1
	Sequence:CCGGCCGTGGCTTGCATTGATAGAACTCGAGTTCTATCAATGCAAGCCACGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121070
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005228.3-3732s1c1
	Sequence:CCGGCCACCAAATTAGCCTGGACAACTCGAGTTGTCCAGGCTAATTTGGTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121069
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: A-431
	TRC Version: 1	Clone ID:NM_005228.3-1246s1c1
	Sequence:CCGGCGCAAAGTGTGTAACGGAATACTCGAGTATTCCGTTACACACTTTGCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121068
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-3849s1c1
	Sequence:CCGGGCCACAAAGCAGTGAATTTATCTCGAGATAAATTCACTGCTTTGTGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121206
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-3787s1c1
	Sequence:CCGGGCCAAGCCAAATGGCATCTTTCTCGAGAAAGATGCCATTTGGCTTGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121205
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005228.3-568s1c1
	Sequence:CCGGAGAGGAAATATGTACTACGAACTCGAGTTCGTAGTACATATTTCCTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121204
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: A-431
	TRC Version: 1	Clone ID:NM_005228.3-396s1c1
	Sequence:CCGGCCTCCAGAGGATGTTCAATAACTCGAGTTATTGAACATCCTCTGGAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121203
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005228.3-2650s1c1
	Sequence:CCGGGTCCGGGAACACAAAGACAATCTCGAGATTGTCTTTGTGTTCCCGGACTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121202
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.5	Cell Line: A-431
	TRC Version: 1	Clone ID:NM_005228.3-5329s1c1
	Sequence:CCGGCCCTGTAACCTGACTGGTTAACTCGAGTTAACCAGTCAGGTTACAGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121331
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: A-431
	TRC Version: 1	Clone ID:NM_005228.3-499s1c1
	Sequence:CCGGGTGGCTGGTTATGTCCTCATTCTCGAGAATGAGGACATAACCAGCCACTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121330
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005228.3-1575s1c1
	Sequence:CCGGGAACATAACATCCTTGGGATTCTCGAGAATCCCAAGGATGTTATGTTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121329
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-2791s1c1
	Sequence:CCGGCAGCATGTCAAGATCACAGATCTCGAGATCTGTGATCTTGACATGCTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121328
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005228.3-1292s1c1
	Sequence:CCGGTCTCCATAAATGCTACGAATACTCGAGTATTCGTAGCATTTATGGAGATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000298822
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005228.3-3095s21c1
	Sequence:CCGGGCTGGATGATAGACGCAGATACTCGAGTATCTGCGTCTATCATCCAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000295968
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.78	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005228.3-4888s21c1
	Sequence:CCGGGCTGCTCTGAAATCTCCTTTACTCGAGTAAAGGAGATTTCAGAGCAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195131
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_005228.3-4725s1c1
	Sequence:CCGGCATTGGATTCATCAGCATTTGCTCGAGCAAATGCTGATGAATCCAATGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199100
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-1411s1c1
	Sequence:CCGGCCACAGGAACTGGATATTCTGCTCGAGCAGAATATCCAGTTCCTGTGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199174
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-2346s1c1
	Sequence:CCGGCCAAGCTCTCTTGAGGATCTTCTCGAGAAGATCCTCAAGAGAGCTTGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199387
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-3557s1c1
	Sequence:CCGGCTGTGCAGAATCCTGTCTATCCTCGAGGATAGACAGGATTCTGCACAGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199532
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.53	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-2874s1c1
	Sequence:CCGGGCCTATCAAGTGGATGGCATTCTCGAGAATGCCATCCACTTGATAGGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000295969
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005228.3-3849s21c1
	Sequence:CCGGGCCACAAAGCAGTGAATTTATCTCGAGATAAATTCACTGCTTTGTGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000295971
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005228.3-396s21c1
	Sequence:CCGGCCTCCAGAGGATGTTCAATAACTCGAGTTATTGAACATCCTCTGGAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000310112
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.87	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005228.3-3787s21c1
	Sequence:CCGGGCCAAGCCAAATGGCATCTTTCTCGAGAAAGATGCCATTTGGCTTGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_005228 VALIDATED	EGFR MISSION shRNA shRNA Plasmid DNA epidermal growth factor receptor	Human

31 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000039636
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005228.3-1216s1c1
	Sequence:CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039633
Product Details Validated	Region:UNK	Mean KnockDown Level: 0.75	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-4682s1c1
	Sequence:CCGGGCTGAGAATGTGGAATACCTACTCGAGTAGGTATTCCACATTCTCAGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039635
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.58	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-2467s1c1
	Sequence:CCGGCCCGTCGCTATCAAGGAATTACTCGAGTAATTCCTTGATAGCGACGGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195303
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.75	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.x-1166s1c1
	Sequence:CCGGCGCAAAGTGTGTAACGGAATACTCGAGTATTCCGTTACACACTTTGCGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000010329
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.9	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.x-4705s1c1
	Sequence:CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039634
Product Details Validated	Region:	Mean KnockDown Level: 0.87	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-3095s1c1
	Sequence:CCGGGCTGGATGATAGACGCAGATACTCGAGTATCTGCGTCTATCATCCAGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121327
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_005228.3-5399s1c1
	Sequence:CCGGCCCATCCAATTTATCAAGGAACTCGAGTTCCTTGATAAATTGGATGGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121067
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.82	Cell Line: A-431
	TRC Version: 1	Clone ID:NM_005228.3-4888s1c1
	Sequence:CCGGGCTGCTCTGAAATCTCCTTTACTCGAGTAAAGGAGATTTCAGAGCAGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121071
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005228.3-3383s1c1
	Sequence:CCGGCCGTGGCTTGCATTGATAGAACTCGAGTTCTATCAATGCAAGCCACGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121070
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005228.3-3732s1c1
	Sequence:CCGGCCACCAAATTAGCCTGGACAACTCGAGTTGTCCAGGCTAATTTGGTGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121069
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: A-431
	TRC Version: 1	Clone ID:NM_005228.3-1246s1c1
	Sequence:CCGGCGCAAAGTGTGTAACGGAATACTCGAGTATTCCGTTACACACTTTGCGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121068
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-3849s1c1
	Sequence:CCGGGCCACAAAGCAGTGAATTTATCTCGAGATAAATTCACTGCTTTGTGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121206
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-3787s1c1
	Sequence:CCGGGCCAAGCCAAATGGCATCTTTCTCGAGAAAGATGCCATTTGGCTTGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121205
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005228.3-568s1c1
	Sequence:CCGGAGAGGAAATATGTACTACGAACTCGAGTTCGTAGTACATATTTCCTCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121204
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: A-431
	TRC Version: 1	Clone ID:NM_005228.3-396s1c1
	Sequence:CCGGCCTCCAGAGGATGTTCAATAACTCGAGTTATTGAACATCCTCTGGAGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121203
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005228.3-2650s1c1
	Sequence:CCGGGTCCGGGAACACAAAGACAATCTCGAGATTGTCTTTGTGTTCCCGGACTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121202
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.5	Cell Line: A-431
	TRC Version: 1	Clone ID:NM_005228.3-5329s1c1
	Sequence:CCGGCCCTGTAACCTGACTGGTTAACTCGAGTTAACCAGTCAGGTTACAGGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121331
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: A-431
	TRC Version: 1	Clone ID:NM_005228.3-499s1c1
	Sequence:CCGGGTGGCTGGTTATGTCCTCATTCTCGAGAATGAGGACATAACCAGCCACTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121330
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005228.3-1575s1c1
	Sequence:CCGGGAACATAACATCCTTGGGATTCTCGAGAATCCCAAGGATGTTATGTTCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121329
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-2791s1c1
	Sequence:CCGGCAGCATGTCAAGATCACAGATCTCGAGATCTGTGATCTTGACATGCTGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121328
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005228.3-1292s1c1
	Sequence:CCGGTCTCCATAAATGCTACGAATACTCGAGTATTCGTAGCATTTATGGAGATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000298822
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005228.3-3095s21c1
	Sequence:CCGGGCTGGATGATAGACGCAGATACTCGAGTATCTGCGTCTATCATCCAGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000295968
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.78	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005228.3-4888s21c1
	Sequence:CCGGGCTGCTCTGAAATCTCCTTTACTCGAGTAAAGGAGATTTCAGAGCAGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195131
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_005228.3-4725s1c1
	Sequence:CCGGCATTGGATTCATCAGCATTTGCTCGAGCAAATGCTGATGAATCCAATGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199100
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-1411s1c1
	Sequence:CCGGCCACAGGAACTGGATATTCTGCTCGAGCAGAATATCCAGTTCCTGTGGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199174
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-2346s1c1
	Sequence:CCGGCCAAGCTCTCTTGAGGATCTTCTCGAGAAGATCCTCAAGAGAGCTTGGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199387
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-3557s1c1
	Sequence:CCGGCTGTGCAGAATCCTGTCTATCCTCGAGGATAGACAGGATTCTGCACAGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199532
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.53	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-2874s1c1
	Sequence:CCGGGCCTATCAAGTGGATGGCATTCTCGAGAATGCCATCCACTTGATAGGCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000295969
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005228.3-3849s21c1
	Sequence:CCGGGCCACAAAGCAGTGAATTTATCTCGAGATAAATTCACTGCTTTGTGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000295971
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005228.3-396s21c1
	Sequence:CCGGCCTCCAGAGGATGTTCAATAACTCGAGTTATTGAACATCCTCTGGAGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000310112
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.87	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005228.3-3787s21c1
	Sequence:CCGGGCCAAGCCAAATGGCATCTTTCTCGAGAAAGATGCCATTTGGCTTGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_005228 VALIDATED	EGFR MISSION shRNA Lentiviral Transduction Particles epidermal growth factor receptor	Human

31 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000039636
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005228.3-1216s1c1
	Sequence:CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039633
Product Details Validated	Region:UNK	Mean KnockDown Level: 0.75	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-4682s1c1
	Sequence:CCGGGCTGAGAATGTGGAATACCTACTCGAGTAGGTATTCCACATTCTCAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039635
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.58	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-2467s1c1
	Sequence:CCGGCCCGTCGCTATCAAGGAATTACTCGAGTAATTCCTTGATAGCGACGGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195303
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.75	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.x-1166s1c1
	Sequence:CCGGCGCAAAGTGTGTAACGGAATACTCGAGTATTCCGTTACACACTTTGCGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000010329
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.9	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.x-4705s1c1
	Sequence:CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039634
Product Details Validated	Region:	Mean KnockDown Level: 0.87	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-3095s1c1
	Sequence:CCGGGCTGGATGATAGACGCAGATACTCGAGTATCTGCGTCTATCATCCAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121327
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_005228.3-5399s1c1
	Sequence:CCGGCCCATCCAATTTATCAAGGAACTCGAGTTCCTTGATAAATTGGATGGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121067
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.82	Cell Line: A-431
	TRC Version: 1	Clone ID:NM_005228.3-4888s1c1
	Sequence:CCGGGCTGCTCTGAAATCTCCTTTACTCGAGTAAAGGAGATTTCAGAGCAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121071
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005228.3-3383s1c1
	Sequence:CCGGCCGTGGCTTGCATTGATAGAACTCGAGTTCTATCAATGCAAGCCACGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121070
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005228.3-3732s1c1
	Sequence:CCGGCCACCAAATTAGCCTGGACAACTCGAGTTGTCCAGGCTAATTTGGTGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121069
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: A-431
	TRC Version: 1	Clone ID:NM_005228.3-1246s1c1
	Sequence:CCGGCGCAAAGTGTGTAACGGAATACTCGAGTATTCCGTTACACACTTTGCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121068
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-3849s1c1
	Sequence:CCGGGCCACAAAGCAGTGAATTTATCTCGAGATAAATTCACTGCTTTGTGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121206
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-3787s1c1
	Sequence:CCGGGCCAAGCCAAATGGCATCTTTCTCGAGAAAGATGCCATTTGGCTTGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121205
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005228.3-568s1c1
	Sequence:CCGGAGAGGAAATATGTACTACGAACTCGAGTTCGTAGTACATATTTCCTCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121204
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: A-431
	TRC Version: 1	Clone ID:NM_005228.3-396s1c1
	Sequence:CCGGCCTCCAGAGGATGTTCAATAACTCGAGTTATTGAACATCCTCTGGAGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121203
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005228.3-2650s1c1
	Sequence:CCGGGTCCGGGAACACAAAGACAATCTCGAGATTGTCTTTGTGTTCCCGGACTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121202
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.5	Cell Line: A-431
	TRC Version: 1	Clone ID:NM_005228.3-5329s1c1
	Sequence:CCGGCCCTGTAACCTGACTGGTTAACTCGAGTTAACCAGTCAGGTTACAGGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121331
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: A-431
	TRC Version: 1	Clone ID:NM_005228.3-499s1c1
	Sequence:CCGGGTGGCTGGTTATGTCCTCATTCTCGAGAATGAGGACATAACCAGCCACTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121330
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005228.3-1575s1c1
	Sequence:CCGGGAACATAACATCCTTGGGATTCTCGAGAATCCCAAGGATGTTATGTTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121329
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-2791s1c1
	Sequence:CCGGCAGCATGTCAAGATCACAGATCTCGAGATCTGTGATCTTGACATGCTGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121328
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005228.3-1292s1c1
	Sequence:CCGGTCTCCATAAATGCTACGAATACTCGAGTATTCGTAGCATTTATGGAGATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000298822
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005228.3-3095s21c1
	Sequence:CCGGGCTGGATGATAGACGCAGATACTCGAGTATCTGCGTCTATCATCCAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000295968
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.78	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005228.3-4888s21c1
	Sequence:CCGGGCTGCTCTGAAATCTCCTTTACTCGAGTAAAGGAGATTTCAGAGCAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195131
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_005228.3-4725s1c1
	Sequence:CCGGCATTGGATTCATCAGCATTTGCTCGAGCAAATGCTGATGAATCCAATGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199100
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-1411s1c1
	Sequence:CCGGCCACAGGAACTGGATATTCTGCTCGAGCAGAATATCCAGTTCCTGTGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199174
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-2346s1c1
	Sequence:CCGGCCAAGCTCTCTTGAGGATCTTCTCGAGAAGATCCTCAAGAGAGCTTGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199387
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-3557s1c1
	Sequence:CCGGCTGTGCAGAATCCTGTCTATCCTCGAGGATAGACAGGATTCTGCACAGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199532
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.53	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005228.3-2874s1c1
	Sequence:CCGGGCCTATCAAGTGGATGGCATTCTCGAGAATGCCATCCACTTGATAGGCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000295969
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005228.3-3849s21c1
	Sequence:CCGGGCCACAAAGCAGTGAATTTATCTCGAGATAAATTCACTGCTTTGTGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000295971
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005228.3-396s21c1
	Sequence:CCGGCCTCCAGAGGATGTTCAATAACTCGAGTTATTGAACATCCTCTGGAGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000310112
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.87	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005228.3-3787s21c1
	Sequence:CCGGGCCAAGCCAAATGGCATCTTTCTCGAGAAAGATGCCATTTGGCTTGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_007912	EGFR MISSION shRNA Bacterial Glycerol Stock epidermal growth factor receptor	Mouse

5 Products Total

TRC Number
We do not support the configuration options you have chosen
TRCN0000023479
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_007912.1-745s1c1
	Sequence:CCGGCCTCTGCAATATGGATACTATCTCGAGATAGTATCCATATTGCAGAGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023480
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_007912.1-1694s1c1
	Sequence:CCGGGCAAACACAATAAACTGGAAACTCGAGTTTCCAGTTTATTGTGTTTGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023481
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_007912.1-643s1c1
	Sequence:CCGGCCTGTCCAACTATGGGACAAACTCGAGTTTGTCCCATAGTTGGACAGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023482
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_007912.1-2218s1c1
	Sequence:CCGGGCAGTGGATCTTAAAGACCTTCTCGAGAAGGTCTTTAAGATCCACTGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023483
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_007912.1-1535s1c1
	Sequence:CCGGGCTTTCGAGAACCTAGAAATACTCGAGTATTTCTAGGTTCTCGAAAGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_007912	EGFR MISSION shRNA shRNA Plasmid DNA epidermal growth factor receptor	Mouse

5 Products Total

TRC Number		Vector
We do not support the configuration options you have chosen
TRCN0000023479
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_007912.1-745s1c1
	Sequence:CCGGCCTCTGCAATATGGATACTATCTCGAGATAGTATCCATATTGCAGAGGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023480
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_007912.1-1694s1c1
	Sequence:CCGGGCAAACACAATAAACTGGAAACTCGAGTTTCCAGTTTATTGTGTTTGCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023481
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_007912.1-643s1c1
	Sequence:CCGGCCTGTCCAACTATGGGACAAACTCGAGTTTGTCCCATAGTTGGACAGGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023482
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_007912.1-2218s1c1
	Sequence:CCGGGCAGTGGATCTTAAAGACCTTCTCGAGAAGGTCTTTAAGATCCACTGCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023483
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_007912.1-1535s1c1
	Sequence:CCGGGCTTTCGAGAACCTAGAAATACTCGAGTATTTCTAGGTTCTCGAAAGCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_007912	EGFR MISSION shRNA Lentiviral Transduction Particles epidermal growth factor receptor	Mouse

5 Products Total

TRC Number	Volume	Vector
We do not support the configuration options you have chosen
TRCN0000023479
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_007912.1-745s1c1
	Sequence:CCGGCCTCTGCAATATGGATACTATCTCGAGATAGTATCCATATTGCAGAGGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023480
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_007912.1-1694s1c1
	Sequence:CCGGGCAAACACAATAAACTGGAAACTCGAGTTTCCAGTTTATTGTGTTTGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023481
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_007912.1-643s1c1
	Sequence:CCGGCCTGTCCAACTATGGGACAAACTCGAGTTTGTCCCATAGTTGGACAGGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023482
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_007912.1-2218s1c1
	Sequence:CCGGGCAGTGGATCTTAAAGACCTTCTCGAGAAGGTCTTTAAGATCCACTGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023483
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_007912.1-1535s1c1
	Sequence:CCGGGCTTTCGAGAACCTAGAAATACTCGAGTATTTCTAGGTTCTCGAAAGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart