EMAIL THIS PAGE TO A FRIEND

EHF

ets homologous factor

131 Gene Product Result for
Synonyms: ESE3 ESE3B ESEJ
Gene ID:
Human(26298) Summary: This gene encodes a protein that belongs to an ETS transcription factor subfamily characterized by epithelial-specific expression (ESEs). The encoded protein acts as a transcriptional repressor and may be involved in epithelial differentiation and carcinogenesis. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Mouse(13661) ets homologous factor
Rat(295965) ets homologous factor
sheep(100913164) ets homologous factor
domestic guinea pig(100725546) ets homologous factor
naked mole-rat(101704926) ets homologous factor
Zebrafish(568223) ets homologous factor
chicken(425791) ets homologous factor
cow(505422) ets homologous factor
domestic cat(101094540) ets homologous factor
dog(483428) ets homologous factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007914 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007914 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007914 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012153 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012153 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012153 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012153 Rosetta Predictions human pricing
NM_001106493 Rosetta Predictions rat pricing
NM_007914 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012153 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055910 predicted 1018
2 SASI_Hs01_00055911 predicted 771
3 SASI_Hs01_00055912 predicted 427
4 SASI_Hs01_00055913 predicted 565
5 SASI_Hs01_00055914 predicted 508
6 SASI_Hs01_00055915 predicted 319
7 SASI_Hs01_00055916 predicted 479
8 SASI_Hs01_00055917 predicted 199
9 SASI_Hs01_00055918 predicted 194
10 SASI_Hs01_00055919 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106493 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219508 predicted 600
2 SASI_Rn02_00219509 predicted 1431
3 SASI_Rn02_00219510 predicted 1478
4 SASI_Rn02_00219511 predicted 580
5 SASI_Rn02_00219512 predicted 528
6 SASI_Rn02_00219513 predicted 939
7 SASI_Rn02_00219514 predicted 709
8 SASI_Rn02_00219515 predicted 277
9 SASI_Rn02_00219516 predicted 1479
10 SASI_Rn02_00219517 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007914 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128188 predicted 235
2 SASI_Mm01_00128189 predicted 516
3 SASI_Mm01_00128190 predicted 1462
4 SASI_Mm01_00128191 predicted 275
5 SASI_Mm01_00128192 predicted 608
6 SASI_Mm01_00128193 predicted 593
7 SASI_Mm01_00128194 predicted 934
8 SASI_Mm01_00128195 predicted 724
9 SASI_Mm01_00128196 predicted 944
10 SASI_Mm01_00128197 predicted 296
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007914
VALIDATED
EHF MISSION shRNA Bacterial Glycerol Stock
ets homologous factor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007914.1-935s1c1
Sequence:CCGGCCGGGCTATGAGATATTACTACTCGAGTAGTAATATCTCATAGCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007914.1-232s1c1
Sequence:CCGGCATGCAATGTTTCCAGCGGTTCTCGAGAACCGCTGGAAACATTGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007914.1-813s1c1
Sequence:CCGGCCAGGACTGATCAAATGGGAACTCGAGTTCCCATTTGATCAGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007914.1-515s1c1
Sequence:CCGGCGCACACAATGTCATTGTCAACTCGAGTTGACAATGACATTGTGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007914.1-992s1c1
Sequence:CCGGGCTGGTCTATAAGTTTGGGAACTCGAGTTCCCAAACTTATAGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007914.3-366s21c1
Sequence:CCGGCTTTCCAGGAGTTCGACATTACTCGAGTAATGTCGAACTCCTGGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007914.3-712s21c1
Sequence:CCGGGGAGCAAGACCACCCTGTAAACTCGAGTTTACAGGGTGGTCTTGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007914.3-2907s21c1
Sequence:CCGGGGGATCGTTACCTAGTTATTACTCGAGTAATAACTAGGTAACGATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007914.3-513s21c1
Sequence:CCGGAGTCCGCACACAATGTCATTGCTCGAGCAATGACATTGTGTGCGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007914.3-774s21c1
Sequence:CCGGGGGAGTTCATCCGAGACATTCCTCGAGGAATGTCTCGGATGAACTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007914
VALIDATED
EHF MISSION shRNA shRNA Plasmid DNA
ets homologous factor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007914.1-935s1c1
Sequence:CCGGCCGGGCTATGAGATATTACTACTCGAGTAGTAATATCTCATAGCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007914.1-232s1c1
Sequence:CCGGCATGCAATGTTTCCAGCGGTTCTCGAGAACCGCTGGAAACATTGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007914.1-813s1c1
Sequence:CCGGCCAGGACTGATCAAATGGGAACTCGAGTTCCCATTTGATCAGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007914.1-515s1c1
Sequence:CCGGCGCACACAATGTCATTGTCAACTCGAGTTGACAATGACATTGTGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007914.1-992s1c1
Sequence:CCGGGCTGGTCTATAAGTTTGGGAACTCGAGTTCCCAAACTTATAGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007914.3-366s21c1
Sequence:CCGGCTTTCCAGGAGTTCGACATTACTCGAGTAATGTCGAACTCCTGGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007914.3-712s21c1
Sequence:CCGGGGAGCAAGACCACCCTGTAAACTCGAGTTTACAGGGTGGTCTTGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007914.3-2907s21c1
Sequence:CCGGGGGATCGTTACCTAGTTATTACTCGAGTAATAACTAGGTAACGATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007914.3-513s21c1
Sequence:CCGGAGTCCGCACACAATGTCATTGCTCGAGCAATGACATTGTGTGCGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007914.3-774s21c1
Sequence:CCGGGGGAGTTCATCCGAGACATTCCTCGAGGAATGTCTCGGATGAACTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007914
VALIDATED
EHF MISSION shRNA Lentiviral Transduction Particles
ets homologous factor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007914.1-935s1c1
Sequence:CCGGCCGGGCTATGAGATATTACTACTCGAGTAGTAATATCTCATAGCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007914.1-232s1c1
Sequence:CCGGCATGCAATGTTTCCAGCGGTTCTCGAGAACCGCTGGAAACATTGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007914.1-813s1c1
Sequence:CCGGCCAGGACTGATCAAATGGGAACTCGAGTTCCCATTTGATCAGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007914.1-515s1c1
Sequence:CCGGCGCACACAATGTCATTGTCAACTCGAGTTGACAATGACATTGTGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007914.1-992s1c1
Sequence:CCGGGCTGGTCTATAAGTTTGGGAACTCGAGTTCCCAAACTTATAGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007914.3-366s21c1
Sequence:CCGGCTTTCCAGGAGTTCGACATTACTCGAGTAATGTCGAACTCCTGGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007914.3-712s21c1
Sequence:CCGGGGAGCAAGACCACCCTGTAAACTCGAGTTTACAGGGTGGTCTTGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007914.3-2907s21c1
Sequence:CCGGGGGATCGTTACCTAGTTATTACTCGAGTAATAACTAGGTAACGATCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007914.3-513s21c1
Sequence:CCGGAGTCCGCACACAATGTCATTGCTCGAGCAATGACATTGTGTGCGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007914.3-774s21c1
Sequence:CCGGGGGAGTTCATCCGAGACATTCCTCGAGGAATGTCTCGGATGAACTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012153
VALIDATED
EHF MISSION shRNA Bacterial Glycerol Stock
ets homologous factor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012153.2-950s1c1
Sequence:CCGGCCGAGCTATGAGATATTACTACTCGAGTAGTAATATCTCATAGCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_012153.2-630s1c1
Sequence:CCGGGTAGATTTGTTGGACAGCAAACTCGAGTTTGCTGTCCAACAAATCTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012153.2-248s1c1
Sequence:CCGGGTGCAATGTTTCCAGTGGGTTCTCGAGAACCCACTGGAAACATTGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012153.2-803s1c1
Sequence:CCGGCATCCTCTTGAACCCAGACAACTCGAGTTGTCTGGGTTCAAGAGGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012153.2-366s1c1
Sequence:CCGGGCCAATTGTATCCCTTTCCAACTCGAGTTGGAAAGGGATACAATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012153.3-479s21c1
Sequence:CCGGAGTCCACACACAATGTCATTGCTCGAGCAATGACATTGTGTGTGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012153.3-1160s21c1
Sequence:CCGGGAAACACTACAGTCGATTAAACTCGAGTTTAATCGACTGTAGTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012153.3-1069s21c1
Sequence:CCGGAGAACTCCTGGACGTAAATATCTCGAGATATTTACGTCCAGGAGTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012153
VALIDATED
EHF MISSION shRNA shRNA Plasmid DNA
ets homologous factor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012153.2-950s1c1
Sequence:CCGGCCGAGCTATGAGATATTACTACTCGAGTAGTAATATCTCATAGCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_012153.2-630s1c1
Sequence:CCGGGTAGATTTGTTGGACAGCAAACTCGAGTTTGCTGTCCAACAAATCTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012153.2-248s1c1
Sequence:CCGGGTGCAATGTTTCCAGTGGGTTCTCGAGAACCCACTGGAAACATTGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012153.2-803s1c1
Sequence:CCGGCATCCTCTTGAACCCAGACAACTCGAGTTGTCTGGGTTCAAGAGGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012153.2-366s1c1
Sequence:CCGGGCCAATTGTATCCCTTTCCAACTCGAGTTGGAAAGGGATACAATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012153.3-479s21c1
Sequence:CCGGAGTCCACACACAATGTCATTGCTCGAGCAATGACATTGTGTGTGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012153.3-1160s21c1
Sequence:CCGGGAAACACTACAGTCGATTAAACTCGAGTTTAATCGACTGTAGTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012153.3-1069s21c1
Sequence:CCGGAGAACTCCTGGACGTAAATATCTCGAGATATTTACGTCCAGGAGTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012153
VALIDATED
EHF MISSION shRNA Lentiviral Transduction Particles
ets homologous factor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012153.2-950s1c1
Sequence:CCGGCCGAGCTATGAGATATTACTACTCGAGTAGTAATATCTCATAGCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_012153.2-630s1c1
Sequence:CCGGGTAGATTTGTTGGACAGCAAACTCGAGTTTGCTGTCCAACAAATCTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012153.2-248s1c1
Sequence:CCGGGTGCAATGTTTCCAGTGGGTTCTCGAGAACCCACTGGAAACATTGCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012153.2-803s1c1
Sequence:CCGGCATCCTCTTGAACCCAGACAACTCGAGTTGTCTGGGTTCAAGAGGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012153.2-366s1c1
Sequence:CCGGGCCAATTGTATCCCTTTCCAACTCGAGTTGGAAAGGGATACAATTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012153.3-479s21c1
Sequence:CCGGAGTCCACACACAATGTCATTGCTCGAGCAATGACATTGTGTGTGGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012153.3-1160s21c1
Sequence:CCGGGAAACACTACAGTCGATTAAACTCGAGTTTAATCGACTGTAGTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012153.3-1069s21c1
Sequence:CCGGAGAACTCCTGGACGTAAATATCTCGAGATATTTACGTCCAGGAGTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)