EMAIL THIS PAGE TO A FRIEND

EIF2B4

eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa

119 Gene Product Result for
Synonyms: EIF-2B EIF2B EIF2Bdelta
Gene ID:
Human(8890) Summary: Eukaryotic initiation factor 2B (EIF2B), which is necessary for protein synthesis, is a GTP exchange factor composed of five different subunits. The protein encoded by this gene is the fourth, or delta, subunit. Defects in this gene are a cause of leukoencephalopathy with vanishing white matter (VWM) and ovarioleukodystrophy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(13667) eukaryotic translation initiation factor 2B, subunit 4 delta
Rat(117019) eukaryotic translation initiation factor 2B, subunit 4 delta
domestic guinea pig(100728060) eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa
naked mole-rat(101715512) eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa
sheep(101117233) eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa
Zebrafish(541548) eukaryotic translation initiation factor 2B, subunit 4 delta
chicken(425800) eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa
dog(475702) eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa
Horse(100055283) eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa
cow(521926) eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa
domestic cat(101098945) eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015636 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015636 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015636 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010122 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010122 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010122 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU019931 MISSION® esiRNA esiRNA targeting mouse Eif2b4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001034116 Rosetta Predictions human pricing
NM_015636 Rosetta Predictions human pricing
NM_172195 Rosetta Predictions human pricing
NM_053950 Rosetta Predictions rat pricing
NM_001127355 Rosetta Predictions mouse pricing
NM_001127356 Rosetta Predictions mouse pricing
NM_010122 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308127 predicted 558
2 SASI_Hs02_00308128 predicted 1089
3 SASI_Hs02_00308129 predicted 713
4 SASI_Hs02_00308130 predicted 597
5 SASI_Hs02_00308131 predicted 635
6 SASI_Hs02_00308132 predicted 570
7 SASI_Hs01_00105898 predicted 1156
8 SASI_Hs02_00308133 predicted 856
9 SASI_Hs02_00308134 predicted 654
10 SASI_Hs02_00308135 predicted 590
11 SASI_Hs01_00105892 predicted 964
12 SASI_Hs01_00105893 predicted 1079
13 SASI_Hs01_00105894 predicted 1132
14 SASI_Hs01_00105895 predicted 1139
15 SASI_Hs01_00105896 predicted 1449
16 SASI_Hs01_00105897 predicted 1426
17 SASI_Hs01_00105899 predicted 1516
18 SASI_Hs01_00105900 predicted 1108
19 SASI_Hs01_00105901 predicted 1136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348234 predicted 550
2 SASI_Hs02_00348235 predicted 1088
3 SASI_Hs02_00348236 predicted 710
4 SASI_Hs02_00348237 predicted 597
5 SASI_Hs02_00348238 predicted 629
6 SASI_Hs02_00348239 predicted 568
7 SASI_Hs01_00192020 predicted 1149
8 SASI_Hs02_00348240 predicted 857
9 SASI_Hs02_00348241 predicted 652
10 SASI_Hs02_00348242 predicted 581
11 SASI_Hs01_00192014 predicted 969
12 SASI_Hs01_00192015 predicted 1080
13 SASI_Hs01_00192016 predicted 1135
14 SASI_Hs01_00192017 predicted 1136
15 SASI_Hs01_00192018 predicted 1437
16 SASI_Hs01_00192019 predicted 1431
17 SASI_Hs01_00192021 predicted 1522
18 SASI_Hs01_00192022 predicted 1112
19 SASI_Hs01_00192023 predicted 1125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367889 predicted 508
2 SASI_Hs02_00367890 predicted 1044
3 SASI_Hs02_00367891 predicted 675
4 SASI_Hs02_00367892 predicted 550
5 SASI_Hs02_00367893 predicted 595
6 SASI_Hs02_00367894 predicted 527
7 SASI_Hs01_00209026 predicted 1110
8 SASI_Hs02_00367895 predicted 815
9 SASI_Hs02_00367896 predicted 604
10 SASI_Hs02_00367897 predicted 539
11 SASI_Hs01_00209020 predicted 930
12 SASI_Hs01_00209021 predicted 1034
13 SASI_Hs01_00209022 predicted 1094
14 SASI_Hs01_00209023 predicted 1100
15 SASI_Hs01_00209024 predicted 1403
16 SASI_Hs01_00209025 predicted 1389
17 SASI_Hs01_00209027 predicted 1475
18 SASI_Hs01_00209028 predicted 1068
19 SASI_Hs01_00209029 predicted 1091
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053950 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083115 predicted 758
2 SASI_Rn01_00083116 predicted 1109
3 SASI_Rn01_00083118 predicted 917
4 SASI_Rn01_00083119 predicted 226
5 SASI_Rn01_00083120 predicted 504
6 SASI_Rn01_00083121 predicted 568
7 SASI_Rn01_00083122 predicted 572
8 SASI_Rn01_00083123 predicted 1023
9 SASI_Rn01_00083124 predicted 514
10 SASI_Rn02_00266909 predicted 222
11 SASI_Rn01_00083117 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127355 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310327 predicted 1259
2 SASI_Mm02_00310328 predicted 968
3 SASI_Mm02_00310329 predicted 1271
4 SASI_Mm02_00310330 predicted 1540
5 SASI_Mm02_00310331 predicted 1074
6 SASI_Mm02_00310332 predicted 663
7 SASI_Mm02_00310333 predicted 768
8 SASI_Mm02_00310334 predicted 1418
9 SASI_Mm02_00310335 predicted 1144
10 SASI_Mm02_00310336 predicted 1463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127356 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310337 predicted 1482
2 SASI_Mm02_00310338 predicted 1188
3 SASI_Mm02_00310339 predicted 1498
4 SASI_Mm02_00310340 predicted 1770
5 SASI_Mm02_00310341 predicted 1292
6 SASI_Mm02_00310342 predicted 884
7 SASI_Mm02_00310343 predicted 990
8 SASI_Mm02_00310344 predicted 1643
9 SASI_Mm02_00310345 predicted 1365
10 SASI_Mm02_00310346 predicted 1680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010122 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170984 predicted 1111
2 SASI_Mm01_00170985 predicted 821
3 SASI_Mm01_00170986 predicted 1129
4 SASI_Mm01_00170987 predicted 1400
5 SASI_Mm01_00170988 predicted 920
6 SASI_Mm01_00170989 predicted 513
7 SASI_Mm01_00170990 predicted 624
8 SASI_Mm01_00170992 predicted 1273
9 SASI_Mm02_00317840 predicted 997
10 SASI_Mm02_00317841 predicted 402
11 SASI_Mm01_00170991 predicted 956
12 SASI_Mm01_00170993 predicted 1280
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015636
VALIDATED
EIF2B4 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000333689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_015636.3-1086s21c1
Sequence:CCGGGCTCAGGCAATTTCACGCTTTCTCGAGAAAGCGTGAAATTGCCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015636.3-1587s21c1
Sequence:CCGGCGGTTGTTGAATCTAGTCTATCTCGAGATAGACTAGATTCAACAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015636.3-582s21c1
Sequence:CCGGCCTCAGGTTGATGACCTACTTCTCGAGAAGTAGGTCATCAACCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015636.3-962s21c1
Sequence:CCGGCAACGCCATCAAGTTCCTTAACTCGAGTTAAGGAACTTGATGGCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015636.3-855s21c1
Sequence:CCGGGATTACACAACACCGCCTAATCTCGAGATTAGGCGGTGTTGTGTAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015636.2-841s1c1
Sequence:CCGGCGCCATCAAGTTCCTTAACAACTCGAGTTGTTAAGGAACTTGATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015636.2-458s1c1
Sequence:CCGGCCTCAGGTTGATGACCTACTTCTCGAGAAGTAGGTCATCAACCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015636.2-838s1c1
Sequence:CCGGCAACGCCATCAAGTTCCTTAACTCGAGTTAAGGAACTTGATGGCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_015636.2-962s1c1
Sequence:CCGGGCTCAGGCAATTTCACGCTTTCTCGAGAAAGCGTGAAATTGCCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_015636.2-1463s1c1
Sequence:CCGGCGGTTGTTGAATCTAGTCTATCTCGAGATAGACTAGATTCAACAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015636
VALIDATED
EIF2B4 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000333689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_015636.3-1086s21c1
Sequence:CCGGGCTCAGGCAATTTCACGCTTTCTCGAGAAAGCGTGAAATTGCCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015636.3-1587s21c1
Sequence:CCGGCGGTTGTTGAATCTAGTCTATCTCGAGATAGACTAGATTCAACAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015636.3-582s21c1
Sequence:CCGGCCTCAGGTTGATGACCTACTTCTCGAGAAGTAGGTCATCAACCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015636.3-962s21c1
Sequence:CCGGCAACGCCATCAAGTTCCTTAACTCGAGTTAAGGAACTTGATGGCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015636.3-855s21c1
Sequence:CCGGGATTACACAACACCGCCTAATCTCGAGATTAGGCGGTGTTGTGTAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015636.2-841s1c1
Sequence:CCGGCGCCATCAAGTTCCTTAACAACTCGAGTTGTTAAGGAACTTGATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015636.2-458s1c1
Sequence:CCGGCCTCAGGTTGATGACCTACTTCTCGAGAAGTAGGTCATCAACCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015636.2-838s1c1
Sequence:CCGGCAACGCCATCAAGTTCCTTAACTCGAGTTAAGGAACTTGATGGCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_015636.2-962s1c1
Sequence:CCGGGCTCAGGCAATTTCACGCTTTCTCGAGAAAGCGTGAAATTGCCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_015636.2-1463s1c1
Sequence:CCGGCGGTTGTTGAATCTAGTCTATCTCGAGATAGACTAGATTCAACAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015636
VALIDATED
EIF2B4 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000333689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_015636.3-1086s21c1
Sequence:CCGGGCTCAGGCAATTTCACGCTTTCTCGAGAAAGCGTGAAATTGCCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015636.3-1587s21c1
Sequence:CCGGCGGTTGTTGAATCTAGTCTATCTCGAGATAGACTAGATTCAACAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015636.3-582s21c1
Sequence:CCGGCCTCAGGTTGATGACCTACTTCTCGAGAAGTAGGTCATCAACCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015636.3-962s21c1
Sequence:CCGGCAACGCCATCAAGTTCCTTAACTCGAGTTAAGGAACTTGATGGCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015636.3-855s21c1
Sequence:CCGGGATTACACAACACCGCCTAATCTCGAGATTAGGCGGTGTTGTGTAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015636.2-841s1c1
Sequence:CCGGCGCCATCAAGTTCCTTAACAACTCGAGTTGTTAAGGAACTTGATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015636.2-458s1c1
Sequence:CCGGCCTCAGGTTGATGACCTACTTCTCGAGAAGTAGGTCATCAACCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015636.2-838s1c1
Sequence:CCGGCAACGCCATCAAGTTCCTTAACTCGAGTTAAGGAACTTGATGGCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_015636.2-962s1c1
Sequence:CCGGGCTCAGGCAATTTCACGCTTTCTCGAGAAAGCGTGAAATTGCCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_015636.2-1463s1c1
Sequence:CCGGCGGTTGTTGAATCTAGTCTATCTCGAGATAGACTAGATTCAACAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010122
VALIDATED
EIF2B4 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010122.2-1308s1c1
Sequence:CCGGGAGGTTTCTAAGGTGCTATTGCTCGAGCAATAGCACCTTAGAAACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010122.2-1108s21c1
Sequence:CCGGGGGACGTGATCCTGGTATATGCTCGAGCATATACCAGGATCACGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010122.2-1308s21c1
Sequence:CCGGGAGGTTTCTAAGGTGCTATTGCTCGAGCAATAGCACCTTAGAAACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010122.2-1497s21c1
Sequence:CCGGCCCGATGATCTGCAGTGTAAGCTCGAGCTTACACTGCAGATCATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010122.2-1066s21c1
Sequence:CCGGCTCAGGCAATTTCACGATTTGCTCGAGCAAATCGTGAAATTGCCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010122.2-860s21c1
Sequence:CCGGACTCTCCAGGGATCTTGTAAACTCGAGTTTACAAGATCCCTGGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010122.1-240s1c1
Sequence:CCGGCCAAGAAATTGGCTCTGCTGTCTCGAGACAGCAGAGCCAATTTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010122.1-580s1c1
Sequence:CCGGCGAAAGGATTACGGATCCAAACTCGAGTTTGGATCCGTAATCCTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010122.1-1387s1c1
Sequence:CCGGGAAACGTACAAGTTCTGTGAACTCGAGTTCACAGAACTTGTACGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010122
VALIDATED
EIF2B4 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010122.2-1308s1c1
Sequence:CCGGGAGGTTTCTAAGGTGCTATTGCTCGAGCAATAGCACCTTAGAAACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010122.2-1108s21c1
Sequence:CCGGGGGACGTGATCCTGGTATATGCTCGAGCATATACCAGGATCACGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010122.2-1308s21c1
Sequence:CCGGGAGGTTTCTAAGGTGCTATTGCTCGAGCAATAGCACCTTAGAAACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010122.2-1497s21c1
Sequence:CCGGCCCGATGATCTGCAGTGTAAGCTCGAGCTTACACTGCAGATCATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010122.2-1066s21c1
Sequence:CCGGCTCAGGCAATTTCACGATTTGCTCGAGCAAATCGTGAAATTGCCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010122.2-860s21c1
Sequence:CCGGACTCTCCAGGGATCTTGTAAACTCGAGTTTACAAGATCCCTGGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010122.1-240s1c1
Sequence:CCGGCCAAGAAATTGGCTCTGCTGTCTCGAGACAGCAGAGCCAATTTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010122.1-580s1c1
Sequence:CCGGCGAAAGGATTACGGATCCAAACTCGAGTTTGGATCCGTAATCCTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010122.1-1387s1c1
Sequence:CCGGGAAACGTACAAGTTCTGTGAACTCGAGTTCACAGAACTTGTACGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010122
VALIDATED
EIF2B4 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010122.2-1308s1c1
Sequence:CCGGGAGGTTTCTAAGGTGCTATTGCTCGAGCAATAGCACCTTAGAAACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010122.2-1108s21c1
Sequence:CCGGGGGACGTGATCCTGGTATATGCTCGAGCATATACCAGGATCACGTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010122.2-1308s21c1
Sequence:CCGGGAGGTTTCTAAGGTGCTATTGCTCGAGCAATAGCACCTTAGAAACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010122.2-1497s21c1
Sequence:CCGGCCCGATGATCTGCAGTGTAAGCTCGAGCTTACACTGCAGATCATCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010122.2-1066s21c1
Sequence:CCGGCTCAGGCAATTTCACGATTTGCTCGAGCAAATCGTGAAATTGCCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010122.2-860s21c1
Sequence:CCGGACTCTCCAGGGATCTTGTAAACTCGAGTTTACAAGATCCCTGGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010122.1-240s1c1
Sequence:CCGGCCAAGAAATTGGCTCTGCTGTCTCGAGACAGCAGAGCCAATTTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010122.1-580s1c1
Sequence:CCGGCGAAAGGATTACGGATCCAAACTCGAGTTTGGATCCGTAATCCTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010122.1-1387s1c1
Sequence:CCGGGAAACGTACAAGTTCTGTGAACTCGAGTTCACAGAACTTGTACGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)