EMAIL THIS PAGE TO A FRIEND

EIF3J

eukaryotic translation initiation factor 3, subunit J

113 Gene Product Result for
Synonyms: EIF3S1 eIF3-alpha eIF3-p35
UniProtKB ID: O75822, Q9BUD2, Q9H8Q2, Q9UI65
Gene ID:
Human(8669) Summary: Eukaryotic initiation factor-3 (EIF3) has a molecular mass of about 600 kD and contains 13 nonidentical protein subunits, including EIF3J. EIF3 plays a central role in binding of initiator methionyl-tRNA and mRNA to the 40S ribosomal subunit to form the 40S initiation complex (Fraser et al., 2004 [PubMed 14688252]
Rat(691947) eukaryotic translation initiation factor 3, subunit J
chicken(415573) eukaryotic translation initiation factor 3, subunit J
domestic cat(101093276) eukaryotic translation initiation factor 3, subunit J
dog(487532) eukaryotic translation initiation factor 3, subunit J
cow(539052) eukaryotic translation initiation factor 3, subunit J
domestic guinea pig(100727249) eukaryotic translation initiation factor 3, subunit J
naked mole-rat(101701210) eukaryotic translation initiation factor 3, subunit J
sheep(101116236) eukaryotic translation initiation factor 3, subunit J
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003758 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003758 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003758 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106071 MISSION® esiRNA esiRNA human EIF3S1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003758 Rosetta Predictions human pricing
NM_001077670 Rosetta Predictions rat pricing
XM_001080279 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003758 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151248 predicted 466
2 SASI_Hs01_00151249 predicted 665
3 SASI_Hs01_00151251 predicted 697
4 SASI_Hs01_00151252 predicted 450
5 SASI_Hs01_00151253 predicted 638
6 SASI_Hs01_00151254 predicted 840
7 SASI_Hs01_00151255 predicted 509
8 SASI_Hs01_00151256 predicted 674
9 SASI_Hs01_00151257 predicted 829
10 SASI_Hs02_00336235 predicted 882
11 SASI_Hs01_00151250 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077670 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207822 predicted 667
2 SASI_Rn02_00207823 predicted 921
3 SASI_Rn02_00207824 predicted 827
4 SASI_Rn02_00207825 predicted 641
5 SASI_Rn02_00207826 predicted 703
6 SASI_Rn02_00207827 predicted 613
7 SASI_Rn02_00207828 predicted 835
8 SASI_Rn02_00207829 predicted 818
9 SASI_Rn02_00207830 predicted 908
10 SASI_Rn02_00207831 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080279 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367415 predicted 666
2 SASI_Rn02_00367416 predicted 454
3 SASI_Rn02_00367417 predicted 825
4 SASI_Rn02_00367418 predicted 612
5 SASI_Rn02_00367419 predicted 834
6 SASI_Rn02_00367420 predicted 818
7 SASI_Rn02_00367421 predicted 911
8 SASI_Rn02_00367422 predicted 851
9 SASI_Rn02_00367423 predicted 640
10 SASI_Rn02_00367424 predicted 970
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003758
VALIDATED
EIF3J MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit J
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003758.2-598s21c1
Sequence:CCGGAGAGTTTGGAAAGTTACTAAACTCGAGTTTAGTAACTTTCCAAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003758.2-845s21c1
Sequence:CCGGCTGGCAGATTATGGTGGTTATCTCGAGATAACCACCATAATCTGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003758.2-457s21c1
Sequence:CCGGAGAAGAACAATTAGCAGATAACTCGAGTTATCTGCTAATTGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003758.2-500s21c1
Sequence:CCGGGAAGAGTCAGACCTCGAATTACTCGAGTAATTCGAGGTCTGACTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003758.2-1106s21c1
Sequence:CCGGGAACCTAAGTTGCTACTAAATCTCGAGATTTAGTAGCAACTTAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003758.1-365s1c1
Sequence:CCGGCCGAAGAACCTAAAGTGCTAACTCGAGTTAGCACTTTAGGTTCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003758.1-781s1c1
Sequence:CCGGGCAGATTATGGTGGTTATGATCTCGAGATCATAACCACCATAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003758.1-388s1c1
Sequence:CCGGCCAGAAGAACAATTAGCAGATCTCGAGATCTGCTAATTGTTCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003758.1-659s1c1
Sequence:CCGGCCAATTCACTGACTGTGCTTTCTCGAGAAAGCACAGTCAGTGAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003758.1-443s1c1
Sequence:CCGGACCTCGAATTAGCAAAGGAAACTCGAGTTTCCTTTGCTAATTCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003758
VALIDATED
EIF3J MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit J
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003758.2-598s21c1
Sequence:CCGGAGAGTTTGGAAAGTTACTAAACTCGAGTTTAGTAACTTTCCAAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003758.2-845s21c1
Sequence:CCGGCTGGCAGATTATGGTGGTTATCTCGAGATAACCACCATAATCTGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003758.2-457s21c1
Sequence:CCGGAGAAGAACAATTAGCAGATAACTCGAGTTATCTGCTAATTGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003758.2-500s21c1
Sequence:CCGGGAAGAGTCAGACCTCGAATTACTCGAGTAATTCGAGGTCTGACTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003758.2-1106s21c1
Sequence:CCGGGAACCTAAGTTGCTACTAAATCTCGAGATTTAGTAGCAACTTAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003758.1-365s1c1
Sequence:CCGGCCGAAGAACCTAAAGTGCTAACTCGAGTTAGCACTTTAGGTTCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003758.1-781s1c1
Sequence:CCGGGCAGATTATGGTGGTTATGATCTCGAGATCATAACCACCATAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003758.1-388s1c1
Sequence:CCGGCCAGAAGAACAATTAGCAGATCTCGAGATCTGCTAATTGTTCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003758.1-659s1c1
Sequence:CCGGCCAATTCACTGACTGTGCTTTCTCGAGAAAGCACAGTCAGTGAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003758.1-443s1c1
Sequence:CCGGACCTCGAATTAGCAAAGGAAACTCGAGTTTCCTTTGCTAATTCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003758
VALIDATED
EIF3J MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit J
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003758.2-598s21c1
Sequence:CCGGAGAGTTTGGAAAGTTACTAAACTCGAGTTTAGTAACTTTCCAAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003758.2-845s21c1
Sequence:CCGGCTGGCAGATTATGGTGGTTATCTCGAGATAACCACCATAATCTGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003758.2-457s21c1
Sequence:CCGGAGAAGAACAATTAGCAGATAACTCGAGTTATCTGCTAATTGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003758.2-500s21c1
Sequence:CCGGGAAGAGTCAGACCTCGAATTACTCGAGTAATTCGAGGTCTGACTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003758.2-1106s21c1
Sequence:CCGGGAACCTAAGTTGCTACTAAATCTCGAGATTTAGTAGCAACTTAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003758.1-365s1c1
Sequence:CCGGCCGAAGAACCTAAAGTGCTAACTCGAGTTAGCACTTTAGGTTCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003758.1-781s1c1
Sequence:CCGGGCAGATTATGGTGGTTATGATCTCGAGATCATAACCACCATAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003758.1-388s1c1
Sequence:CCGGCCAGAAGAACAATTAGCAGATCTCGAGATCTGCTAATTGTTCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003758.1-659s1c1
Sequence:CCGGCCAATTCACTGACTGTGCTTTCTCGAGAAAGCACAGTCAGTGAATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003758.1-443s1c1
Sequence:CCGGACCTCGAATTAGCAAAGGAAACTCGAGTTTCCTTTGCTAATTCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)