EMAIL THIS PAGE TO A FRIEND

EIF5

eukaryotic translation initiation factor 5

164 Gene Product Result for
Synonyms: EIF-5 EIF-5A
UniProtKB ID: P55010, Q53XB3, Q9H5N2, Q9UG48
Gene ID:
Human(1983) Summary: Eukaryotic translation initiation factor-5 (EIF5) interacts with the 40S initiation complex to promote hydrolysis of bound GTP with concomitant joining of the 60S ribosomal subunit to the 40S initiation complex. The resulting functional 80S ribosomal initiation complex is then active in peptidyl transfer and chain elongations (summary by Si et al., 1996 [PubMed 8663286]
Mouse(217869) eukaryotic translation initiation factor 5
Rat(56783) eukaryotic translation initiation factor 5
Zebrafish(322256) eukaryotic translation initiation factor 5
fruit fly(32566) CG9177 gene product from transcript CG9177-RE
cow(504752) eukaryotic translation initiation factor 5
Horse(100055152) eukaryotic translation initiation factor 5
domestic cat(101097737) eukaryotic translation initiation factor 5
dog(480442) eukaryotic translation initiation factor 5
chicken(423479) eukaryotic translation initiation factor 5
domestic guinea pig(100735521) eukaryotic translation initiation factor 5
naked mole-rat(101714778) eukaryotic translation initiation factor 5
sheep(101104786) eukaryotic translation initiation factor 5
Domestic Rabbit(100358823) eukaryotic translation initiation factor 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173363 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173363 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173363 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001969 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001969 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001969 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001969 Rosetta Predictions human pricing
NM_183004 Rosetta Predictions human pricing
NM_020075 Rosetta Predictions rat pricing
NM_173363 Rosetta Predictions mouse pricing
NM_178041 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051999 predicted 577
2 SASI_Hs01_00052001 predicted 1299
3 SASI_Hs01_00052002 predicted 608
4 SASI_Hs01_00052003 predicted 609
5 SASI_Hs01_00052004 predicted 550
6 SASI_Hs01_00052005 predicted 1790
7 SASI_Hs01_00052006 predicted 1529
8 SASI_Hs01_00052007 predicted 1796
9 SASI_Hs02_00332929 predicted 1630
10 SASI_Hs02_00332930 predicted 1826
11 SASI_Hs01_00051998 predicted 622
12 SASI_Hs01_00052000 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198280 predicted 545
2 SASI_Hs01_00198282 predicted 1272
3 SASI_Hs01_00198283 predicted 573
4 SASI_Hs01_00198284 predicted 586
5 SASI_Hs01_00198285 predicted 525
6 SASI_Hs01_00198286 predicted 1769
7 SASI_Hs01_00198287 predicted 1508
8 SASI_Hs01_00198288 predicted 1769
9 SASI_Hs02_00371159 predicted 1609
10 SASI_Hs02_00371160 predicted 1799
11 SASI_Hs01_00198279 predicted 594
12 SASI_Hs01_00198281 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020075 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262468 predicted 932
2 SASI_Rn02_00262469 predicted 1486
3 SASI_Rn02_00262470 predicted 1499
4 SASI_Rn02_00262471 predicted 1467
5 SASI_Rn02_00262472 predicted 1329
6 SASI_Rn02_00262473 predicted 1474
7 SASI_Rn02_00262474 predicted 310
8 SASI_Rn02_00262475 predicted 391
9 SASI_Rn02_00262476 predicted 1156
10 SASI_Rn02_00262477 predicted 315
11 SASI_Rn01_00061416 predicted 1024
12 SASI_Rn01_00061417 predicted 1616
13 SASI_Rn01_00061418 predicted 1073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173363 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345170 predicted 1250
2 SASI_Mm01_00186345 predicted 1545
3 SASI_Mm01_00186346 predicted 1565
4 SASI_Mm01_00186347 predicted 1690
5 SASI_Mm01_00186349 predicted 1839
6 SASI_Mm02_00345171 predicted 1324
7 SASI_Mm01_00186350 predicted 1807
8 SASI_Mm02_00345172 predicted 1647
9 SASI_Mm01_00186351 predicted 1832
10 SASI_Mm01_00186352 predicted 1564
11 SASI_Mm01_00186348 predicted 238
12 SASI_Mm01_00186353 predicted 1524
13 SASI_Mm01_00186354 predicted 1490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178041 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348492 predicted 1105
2 SASI_Mm02_00348493 predicted 1407
3 SASI_Mm02_00348494 predicted 1421
4 SASI_Mm02_00348495 predicted 1550
5 SASI_Mm02_00348496 predicted 1702
6 SASI_Mm02_00348497 predicted 1190
7 SASI_Mm02_00348498 predicted 1664
8 SASI_Mm02_00348499 predicted 1503
9 SASI_Mm02_00348500 predicted 1693
10 SASI_Mm02_00348501 predicted 1430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173363
VALIDATED
EIF5 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173363.2-1067s1c1
Sequence:CCGGCCTCTAAGAAATATGTCTCAACTCGAGTTGAGACATATTTCTTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173363.2-433s1c1
Sequence:CCGGCCACCTGAGAATAGTGACATTCTCGAGAATGTCACTATTCTCAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173363.2-33s1c1
Sequence:CCGGCCAGTTCTATCGCTACAAGATCTCGAGATCTTGTAGCGATAGAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173363.4-772s21c1
Sequence:CCGGTGGATCTCATGAGGCGAATAACTCGAGTTATTCGCCTCATGAGATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173363.4-1608s21c1
Sequence:CCGGCCTCTAAGAAATATGTCTCAACTCGAGTTGAGACATATTTCTTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173363.4-974s21c1
Sequence:CCGGCCACCTGAGAATAGTGACATTCTCGAGAATGTCACTATTCTCAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173363.4-1962s21c1
Sequence:CCGGTTACTGTGAGTGGTCTATAATCTCGAGATTATAGACCACTCACAGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173363.4-662s21c1
Sequence:CCGGGACGTTGCAAAGGCGCTTAATCTCGAGATTAAGCGCCTTTGCAACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173363
VALIDATED
EIF5 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173363.2-1067s1c1
Sequence:CCGGCCTCTAAGAAATATGTCTCAACTCGAGTTGAGACATATTTCTTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173363.2-433s1c1
Sequence:CCGGCCACCTGAGAATAGTGACATTCTCGAGAATGTCACTATTCTCAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173363.2-33s1c1
Sequence:CCGGCCAGTTCTATCGCTACAAGATCTCGAGATCTTGTAGCGATAGAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173363.4-772s21c1
Sequence:CCGGTGGATCTCATGAGGCGAATAACTCGAGTTATTCGCCTCATGAGATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173363.4-1608s21c1
Sequence:CCGGCCTCTAAGAAATATGTCTCAACTCGAGTTGAGACATATTTCTTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173363.4-974s21c1
Sequence:CCGGCCACCTGAGAATAGTGACATTCTCGAGAATGTCACTATTCTCAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173363.4-1962s21c1
Sequence:CCGGTTACTGTGAGTGGTCTATAATCTCGAGATTATAGACCACTCACAGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173363.4-662s21c1
Sequence:CCGGGACGTTGCAAAGGCGCTTAATCTCGAGATTAAGCGCCTTTGCAACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173363
VALIDATED
EIF5 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173363.2-1067s1c1
Sequence:CCGGCCTCTAAGAAATATGTCTCAACTCGAGTTGAGACATATTTCTTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173363.2-433s1c1
Sequence:CCGGCCACCTGAGAATAGTGACATTCTCGAGAATGTCACTATTCTCAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173363.2-33s1c1
Sequence:CCGGCCAGTTCTATCGCTACAAGATCTCGAGATCTTGTAGCGATAGAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173363.4-772s21c1
Sequence:CCGGTGGATCTCATGAGGCGAATAACTCGAGTTATTCGCCTCATGAGATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173363.4-1608s21c1
Sequence:CCGGCCTCTAAGAAATATGTCTCAACTCGAGTTGAGACATATTTCTTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173363.4-974s21c1
Sequence:CCGGCCACCTGAGAATAGTGACATTCTCGAGAATGTCACTATTCTCAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173363.4-1962s21c1
Sequence:CCGGTTACTGTGAGTGGTCTATAATCTCGAGATTATAGACCACTCACAGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173363.4-662s21c1
Sequence:CCGGGACGTTGCAAAGGCGCTTAATCTCGAGATTAAGCGCCTTTGCAACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001969
VALIDATED
EIF5 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 5
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001969.3-1717s1c1
Sequence:CCGGGAGAACATTGAGGTGGTGTATCTCGAGATACACCACCTCAATGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001969.3-1624s1c1
Sequence:CCGGGCCAAAGAGATTCGTGTCAAACTCGAGTTTGACACGAATCTCTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148446    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001969.3-4021s1c1
Sequence:CCGGCCGTTGCTTTGGATTTGTGTTCTCGAGAACACAAATCCAAAGCAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001969.3-1767s1c1
Sequence:CCGGGACTGTAAAGTCAGACAACAACTCGAGTTGTTGTCTGACTTTACAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001969.3-3092s1c1
Sequence:CCGGGCTTTAGATTTGGACACACAACTCGAGTTGTGTGTCCAAATCTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001969.3-1789s1c1
Sequence:CCGGGATGACGACATCGATATTGATCTCGAGATCAATATCGATGTCGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001969.3-1202s1c1
Sequence:CCGGCACTCAGTGATGATTTGGAAACTCGAGTTTCCAAATCATCACTGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001969.3-555s1c1
Sequence:CCGGCCAGTTCTATCGCTACAAGATCTCGAGATCTTGTAGCGATAGAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001969.3-670s1c1
Sequence:CCGGCCAACGTATCCCACCAAATATCTCGAGATATTTGGTGGGATACGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001969.3-643s21c1
Sequence:CCGGGACGTTGCAAAGGCGCTTAATCTCGAGATTAAGCGCCTTTGCAACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_001969.3-670s21c1
Sequence:CCGGCCAACGTATCCCACCAAATATCTCGAGATATTTGGTGGGATACGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001969.3-1624s21c1
Sequence:CCGGGCCAAAGAGATTCGTGTCAAACTCGAGTTTGACACGAATCTCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001969.3-1202s21c1
Sequence:CCGGCACTCAGTGATGATTTGGAAACTCGAGTTTCCAAATCATCACTGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001969
VALIDATED
EIF5 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 5
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001969.3-1717s1c1
Sequence:CCGGGAGAACATTGAGGTGGTGTATCTCGAGATACACCACCTCAATGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001969.3-1624s1c1
Sequence:CCGGGCCAAAGAGATTCGTGTCAAACTCGAGTTTGACACGAATCTCTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148446    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001969.3-4021s1c1
Sequence:CCGGCCGTTGCTTTGGATTTGTGTTCTCGAGAACACAAATCCAAAGCAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001969.3-1767s1c1
Sequence:CCGGGACTGTAAAGTCAGACAACAACTCGAGTTGTTGTCTGACTTTACAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001969.3-3092s1c1
Sequence:CCGGGCTTTAGATTTGGACACACAACTCGAGTTGTGTGTCCAAATCTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001969.3-1789s1c1
Sequence:CCGGGATGACGACATCGATATTGATCTCGAGATCAATATCGATGTCGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001969.3-1202s1c1
Sequence:CCGGCACTCAGTGATGATTTGGAAACTCGAGTTTCCAAATCATCACTGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001969.3-555s1c1
Sequence:CCGGCCAGTTCTATCGCTACAAGATCTCGAGATCTTGTAGCGATAGAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001969.3-670s1c1
Sequence:CCGGCCAACGTATCCCACCAAATATCTCGAGATATTTGGTGGGATACGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001969.3-643s21c1
Sequence:CCGGGACGTTGCAAAGGCGCTTAATCTCGAGATTAAGCGCCTTTGCAACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_001969.3-670s21c1
Sequence:CCGGCCAACGTATCCCACCAAATATCTCGAGATATTTGGTGGGATACGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001969.3-1624s21c1
Sequence:CCGGGCCAAAGAGATTCGTGTCAAACTCGAGTTTGACACGAATCTCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001969.3-1202s21c1
Sequence:CCGGCACTCAGTGATGATTTGGAAACTCGAGTTTCCAAATCATCACTGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001969
VALIDATED
EIF5 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 5
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001969.3-1717s1c1
Sequence:CCGGGAGAACATTGAGGTGGTGTATCTCGAGATACACCACCTCAATGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001969.3-1624s1c1
Sequence:CCGGGCCAAAGAGATTCGTGTCAAACTCGAGTTTGACACGAATCTCTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148446    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001969.3-4021s1c1
Sequence:CCGGCCGTTGCTTTGGATTTGTGTTCTCGAGAACACAAATCCAAAGCAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001969.3-1767s1c1
Sequence:CCGGGACTGTAAAGTCAGACAACAACTCGAGTTGTTGTCTGACTTTACAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001969.3-3092s1c1
Sequence:CCGGGCTTTAGATTTGGACACACAACTCGAGTTGTGTGTCCAAATCTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001969.3-1789s1c1
Sequence:CCGGGATGACGACATCGATATTGATCTCGAGATCAATATCGATGTCGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001969.3-1202s1c1
Sequence:CCGGCACTCAGTGATGATTTGGAAACTCGAGTTTCCAAATCATCACTGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001969.3-555s1c1
Sequence:CCGGCCAGTTCTATCGCTACAAGATCTCGAGATCTTGTAGCGATAGAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001969.3-670s1c1
Sequence:CCGGCCAACGTATCCCACCAAATATCTCGAGATATTTGGTGGGATACGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001969.3-643s21c1
Sequence:CCGGGACGTTGCAAAGGCGCTTAATCTCGAGATTAAGCGCCTTTGCAACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_001969.3-670s21c1
Sequence:CCGGCCAACGTATCCCACCAAATATCTCGAGATATTTGGTGGGATACGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001969.3-1624s21c1
Sequence:CCGGGCCAAAGAGATTCGTGTCAAACTCGAGTTTGACACGAATCTCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001969.3-1202s21c1
Sequence:CCGGCACTCAGTGATGATTTGGAAACTCGAGTTTCCAAATCATCACTGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)