EMAIL THIS PAGE TO A FRIEND

ELL3

elongation factor RNA polymerase II-like 3

82 Gene Product Result for
UniProtKB ID: Q9HB65, B3KQ66, B3KX08, Q6I9Z7, Q9H634
Gene ID:
Mouse(269344) elongation factor RNA polymerase II-like 3
Rat(296102) elongation factor RNA polymerase II-like 3
cow(512648) elongation factor RNA polymerase II-like 3
Horse(100070769) elongation factor RNA polymerase II-like 3
dog(487526) elongation factor RNA polymerase II-like 3
domestic cat(101096988) elongation factor RNA polymerase II-like 3
sheep(101110708) elongation factor RNA polymerase II-like 3
Domestic Rabbit(100328686) elongation factor RNA polymerase II-like 3
naked mole-rat(101725982) elongation factor RNA polymerase II-like 3
domestic guinea pig(100718141) elongation factor RNA polymerase II-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025165 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025165 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025165 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145973 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145973 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145973 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025165 Rosetta Predictions human pricing
NM_001011957 Rosetta Predictions rat pricing
XM_575220 Rosetta Predictions rat pricing
NM_145973 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123469 predicted 1530
2 SASI_Hs01_00123470 predicted 1641
3 SASI_Hs01_00123471 predicted 1205
4 SASI_Hs01_00123472 predicted 725
5 SASI_Hs01_00123473 predicted 1127
6 SASI_Hs01_00123474 predicted 766
7 SASI_Hs01_00123475 predicted 837
8 SASI_Hs01_00123476 predicted 1447
9 SASI_Hs01_00123477 predicted 816
10 SASI_Hs01_00123478 predicted 1548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011957 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068759 predicted 324
2 SASI_Rn01_00068760 predicted 1066
3 SASI_Rn01_00068761 predicted 1133
4 SASI_Rn01_00068762 predicted 1166
5 SASI_Rn01_00068763 predicted 1149
6 SASI_Rn01_00068764 predicted 592
7 SASI_Rn01_00068765 predicted 940
8 SASI_Rn02_00199973 predicted 680
9 SASI_Rn01_00068767 predicted 1142
10 SASI_Rn02_00199974 predicted 1064
11 SASI_Rn01_00068766 predicted 829
12 SASI_Rn01_00068768 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575220 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00134358 predicted 321
2 SASI_Rn01_00134359 predicted 284
3 SASI_Rn01_00134360 predicted 403
4 SASI_Rn01_00134361 predicted 357
5 SASI_Rn01_00134362 predicted 253
6 SASI_Rn01_00134363 predicted 365
7 SASI_Rn01_00134364 predicted 355
8 SASI_Rn01_00134365 predicted 436
9 SASI_Rn01_00134366 predicted 335
10 SASI_Rn01_00134367 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145973 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124069 predicted 380
2 SASI_Mm01_00124070 predicted 1113
3 SASI_Mm02_00341469 predicted 1002
4 SASI_Mm01_00124071 predicted 969
5 SASI_Mm01_00124073 predicted 350
6 SASI_Mm02_00341470 predicted 394
7 SASI_Mm02_00341471 predicted 1106
8 SASI_Mm01_00124076 predicted 765
9 SASI_Mm01_00124078 predicted 782
10 SASI_Mm02_00341472 predicted 989
11 SASI_Mm01_00124072 predicted 624
12 SASI_Mm01_00124074 predicted 928
13 SASI_Mm01_00124075 predicted 1068
14 SASI_Mm01_00124077 predicted 852
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025165
VALIDATED
ELL3 MISSION shRNA Bacterial Glycerol Stock
elongation factor RNA polymerase II-like 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025165.2-1521s21c1
Sequence:CCGGGTGAGTACCTTCACCAGAAATCTCGAGATTTCTGGTGAAGGTACTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025165.2-1641s21c1
Sequence:CCGGAGGAACAAAGCAGCTATAAACCTCGAGGTTTATAGCTGCTTTGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_025165.2-1315s21c1
Sequence:CCGGGCAGGACTTTGAGACAGATTACTCGAGTAATCTGTCTCAAAGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_025165.2-1594s21c1
Sequence:CCGGCTGAAGTTATCAAGGGAATTTCTCGAGAAATTCCCTTGATAACTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025165.1-412s1c1
Sequence:CCGGCCTCATTATTTGGGCAGCCATCTCGAGATGGCTGCCCAAATAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025165.1-1133s1c1
Sequence:CCGGGACAAGATAATCCAGGAATATCTCGAGATATTCCTGGATTATCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025165.1-997s1c1
Sequence:CCGGGCAGGACTTTGAGACAGATTACTCGAGTAATCTGTCTCAAAGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_025165.1-749s1c1
Sequence:CCGGGCCACTGTAGAACTGGAAGAACTCGAGTTCTTCCAGTTCTACAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025165.1-1112s1c1
Sequence:CCGGCCAGAATACAAGGTCCTGGAACTCGAGTTCCAGGACCTTGTATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025165.2-1371s21c1
Sequence:CCGGCTGCAAGCCAAAGGTTCATAGCTCGAGCTATGAACCTTTGGCTTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025165
VALIDATED
ELL3 MISSION shRNA shRNA Plasmid DNA
elongation factor RNA polymerase II-like 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025165.2-1521s21c1
Sequence:CCGGGTGAGTACCTTCACCAGAAATCTCGAGATTTCTGGTGAAGGTACTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025165.2-1641s21c1
Sequence:CCGGAGGAACAAAGCAGCTATAAACCTCGAGGTTTATAGCTGCTTTGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_025165.2-1315s21c1
Sequence:CCGGGCAGGACTTTGAGACAGATTACTCGAGTAATCTGTCTCAAAGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_025165.2-1594s21c1
Sequence:CCGGCTGAAGTTATCAAGGGAATTTCTCGAGAAATTCCCTTGATAACTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025165.1-412s1c1
Sequence:CCGGCCTCATTATTTGGGCAGCCATCTCGAGATGGCTGCCCAAATAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025165.1-1133s1c1
Sequence:CCGGGACAAGATAATCCAGGAATATCTCGAGATATTCCTGGATTATCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025165.1-997s1c1
Sequence:CCGGGCAGGACTTTGAGACAGATTACTCGAGTAATCTGTCTCAAAGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_025165.1-749s1c1
Sequence:CCGGGCCACTGTAGAACTGGAAGAACTCGAGTTCTTCCAGTTCTACAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025165.1-1112s1c1
Sequence:CCGGCCAGAATACAAGGTCCTGGAACTCGAGTTCCAGGACCTTGTATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025165.2-1371s21c1
Sequence:CCGGCTGCAAGCCAAAGGTTCATAGCTCGAGCTATGAACCTTTGGCTTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025165
VALIDATED
ELL3 MISSION shRNA Lentiviral Transduction Particles
elongation factor RNA polymerase II-like 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025165.2-1521s21c1
Sequence:CCGGGTGAGTACCTTCACCAGAAATCTCGAGATTTCTGGTGAAGGTACTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025165.2-1641s21c1
Sequence:CCGGAGGAACAAAGCAGCTATAAACCTCGAGGTTTATAGCTGCTTTGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_025165.2-1315s21c1
Sequence:CCGGGCAGGACTTTGAGACAGATTACTCGAGTAATCTGTCTCAAAGTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_025165.2-1594s21c1
Sequence:CCGGCTGAAGTTATCAAGGGAATTTCTCGAGAAATTCCCTTGATAACTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025165.1-412s1c1
Sequence:CCGGCCTCATTATTTGGGCAGCCATCTCGAGATGGCTGCCCAAATAATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025165.1-1133s1c1
Sequence:CCGGGACAAGATAATCCAGGAATATCTCGAGATATTCCTGGATTATCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025165.1-997s1c1
Sequence:CCGGGCAGGACTTTGAGACAGATTACTCGAGTAATCTGTCTCAAAGTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_025165.1-749s1c1
Sequence:CCGGGCCACTGTAGAACTGGAAGAACTCGAGTTCTTCCAGTTCTACAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025165.1-1112s1c1
Sequence:CCGGCCAGAATACAAGGTCCTGGAACTCGAGTTCCAGGACCTTGTATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025165.2-1371s21c1
Sequence:CCGGCTGCAAGCCAAAGGTTCATAGCTCGAGCTATGAACCTTTGGCTTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145973
ELL3 MISSION shRNA Bacterial Glycerol Stock
elongation factor RNA polymerase II-like 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145973.2-1197s1c1
Sequence:CCGGCATCAGAAACTGTCCCACATTCTCGAGAATGTGGGACAGTTTCTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145973.2-708s1c1
Sequence:CCGGGCACCTATAACCACTGAAGAACTCGAGTTCTTCAGTGGTTATAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145973.2-1360s1c1
Sequence:CCGGCCTAGGTTCTTGCAGTTTGATCTCGAGATCAAACTGCAAGAACCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145973.2-1196s1c1
Sequence:CCGGGCATCAGAAACTGTCCCACATCTCGAGATGTGGGACAGTTTCTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145973.2-1116s1c1
Sequence:CCGGGACAAGATAGTCCAGGAGTATCTCGAGATACTCCTGGACTATCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145973
ELL3 MISSION shRNA shRNA Plasmid DNA
elongation factor RNA polymerase II-like 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145973.2-1197s1c1
Sequence:CCGGCATCAGAAACTGTCCCACATTCTCGAGAATGTGGGACAGTTTCTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145973.2-708s1c1
Sequence:CCGGGCACCTATAACCACTGAAGAACTCGAGTTCTTCAGTGGTTATAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145973.2-1360s1c1
Sequence:CCGGCCTAGGTTCTTGCAGTTTGATCTCGAGATCAAACTGCAAGAACCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145973.2-1196s1c1
Sequence:CCGGGCATCAGAAACTGTCCCACATCTCGAGATGTGGGACAGTTTCTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145973.2-1116s1c1
Sequence:CCGGGACAAGATAGTCCAGGAGTATCTCGAGATACTCCTGGACTATCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145973
ELL3 MISSION shRNA Lentiviral Transduction Particles
elongation factor RNA polymerase II-like 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145973.2-1197s1c1
Sequence:CCGGCATCAGAAACTGTCCCACATTCTCGAGAATGTGGGACAGTTTCTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145973.2-708s1c1
Sequence:CCGGGCACCTATAACCACTGAAGAACTCGAGTTCTTCAGTGGTTATAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145973.2-1360s1c1
Sequence:CCGGCCTAGGTTCTTGCAGTTTGATCTCGAGATCAAACTGCAAGAACCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145973.2-1196s1c1
Sequence:CCGGGCATCAGAAACTGTCCCACATCTCGAGATGTGGGACAGTTTCTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145973.2-1116s1c1
Sequence:CCGGGACAAGATAGTCCAGGAGTATCTCGAGATACTCCTGGACTATCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)