EMAIL THIS PAGE TO A FRIEND

EME1

essential meiotic structure-specific endonuclease 1

56 Gene Product Result for
Synonyms: MMS4L SLX2A
UniProtKB ID: Q96AY2, Q96N62
Gene ID:
Human(146956) Summary: This gene encodes a protein that complexes with methyl methanesulfonate-sensitive UV-sensitive 81 protein to form an endonuclease complex. The encoded protein interacts with specifc DNA structures including nicked Holliday junctions, 3'-flap structures and aberrant replication fork structures. This protein may be involved in repairing DNA damage and in maintaining genomic stability. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
Mouse(268465) essential meiotic endonuclease 1 homolog 1 (S. pombe)
Rat(287634) essential meiotic structure-specific endonuclease 1
domestic guinea pig(100732469) essential meiotic endonuclease 1 homolog 1 (S. pombe)
naked mole-rat(101705463) essential meiotic endonuclease 1 homolog 1 (S. pombe)
sheep(101106603) essential meiotic endonuclease 1 homolog 1 (S. pombe)
Zebrafish(558350) essential meiotic endonuclease 1 homolog 1 (S. pombe)
cow(100125299) essential meiotic endonuclease 1 homolog 1 (S. pombe)
Horse(100056366) essential meiotic endonuclease 1 homolog 1 (S. pombe)
domestic cat(101091164) essential meiotic endonuclease 1 homolog 1 (S. pombe)
dog(491079) essential meiotic endonuclease 1 homolog 1 (S. pombe)
chicken(422104) essential meiotic endonuclease 1 homolog 1 (S. pombe)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152463 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152463 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152463 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177752 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177752 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177752 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU063801 MISSION® esiRNA esiRNA targeting mouse Eme1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152463 Rosetta Predictions human pricing
NM_001105830 Rosetta Predictions rat pricing
NM_177752 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101486 predicted 1025
2 SASI_Hs01_00101487 predicted 1033
3 SASI_Hs01_00101488 predicted 365
4 SASI_Hs01_00101489 predicted 1633
5 SASI_Hs01_00101490 predicted 1103
6 SASI_Hs01_00101491 predicted 268
7 SASI_Hs01_00101492 predicted 1156
8 SASI_Hs01_00101493 predicted 547
9 SASI_Hs01_00101494 predicted 530
10 SASI_Hs02_00366239 predicted 371
11 SASI_Hs01_00101485 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105830 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212946 predicted 1031
2 SASI_Rn02_00212947 predicted 491
3 SASI_Rn02_00212948 predicted 696
4 SASI_Rn02_00212949 predicted 287
5 SASI_Rn02_00212950 predicted 1481
6 SASI_Rn02_00212951 predicted 1360
7 SASI_Rn02_00212952 predicted 900
8 SASI_Rn02_00212953 predicted 838
9 SASI_Rn02_00212954 predicted 1429
10 SASI_Rn02_00212955 predicted 923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177752 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166996 predicted 993
2 SASI_Mm01_00166997 predicted 1217
3 SASI_Mm01_00166998 predicted 211
4 SASI_Mm01_00166999 predicted 657
5 SASI_Mm01_00167000 predicted 1217
6 SASI_Mm01_00167001 predicted 797
7 SASI_Mm01_00167002 predicted 202
8 SASI_Mm01_00167003 predicted 265
9 SASI_Mm01_00167004 predicted 920
10 SASI_Mm02_00348131 predicted 1150
11 SASI_Mm01_00167005 predicted 1175
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152463
VALIDATED
EME1 MISSION shRNA Bacterial Glycerol Stock
essential meiotic structure-specific endonuclease 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152463.2-1913s21c1
Sequence:CCGGAGTCTTTCTTGGGTCTTATTACTCGAGTAATAAGACCCAAGAAAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152463.2-1982s21c1
Sequence:CCGGGCCACCTACCTTTGGCATTTACTCGAGTAAATGCCAAAGGTAGGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152463.1-1077s1c1
Sequence:CCGGGCACTATGAAAGGGAAGGAAACTCGAGTTTCCTTCCCTTTCATAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152463.1-485s1c1
Sequence:CCGGCCCTTTCCAAAGATCCCTGAACTCGAGTTCAGGGATCTTTGGAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_152463.1-1723s1c1
Sequence:CCGGCAGGCGTATCTACCTTCAGATCTCGAGATCTGAAGGTAGATACGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_152463.1-747s1c1
Sequence:CCGGCCCTGAGAAGACAGGAAAGAACTCGAGTTCTTTCCTGTCTTCTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_152463.1-1629s1c1
Sequence:CCGGCGGATAAAGAACGCCAGAATTCTCGAGAATTCTGGCGTTCTTTATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152463
VALIDATED
EME1 MISSION shRNA shRNA Plasmid DNA
essential meiotic structure-specific endonuclease 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152463.2-1913s21c1
Sequence:CCGGAGTCTTTCTTGGGTCTTATTACTCGAGTAATAAGACCCAAGAAAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152463.2-1982s21c1
Sequence:CCGGGCCACCTACCTTTGGCATTTACTCGAGTAAATGCCAAAGGTAGGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152463.1-1077s1c1
Sequence:CCGGGCACTATGAAAGGGAAGGAAACTCGAGTTTCCTTCCCTTTCATAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152463.1-485s1c1
Sequence:CCGGCCCTTTCCAAAGATCCCTGAACTCGAGTTCAGGGATCTTTGGAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_152463.1-1723s1c1
Sequence:CCGGCAGGCGTATCTACCTTCAGATCTCGAGATCTGAAGGTAGATACGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_152463.1-747s1c1
Sequence:CCGGCCCTGAGAAGACAGGAAAGAACTCGAGTTCTTTCCTGTCTTCTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_152463.1-1629s1c1
Sequence:CCGGCGGATAAAGAACGCCAGAATTCTCGAGAATTCTGGCGTTCTTTATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152463
VALIDATED
EME1 MISSION shRNA Lentiviral Transduction Particles
essential meiotic structure-specific endonuclease 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152463.2-1913s21c1
Sequence:CCGGAGTCTTTCTTGGGTCTTATTACTCGAGTAATAAGACCCAAGAAAGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152463.2-1982s21c1
Sequence:CCGGGCCACCTACCTTTGGCATTTACTCGAGTAAATGCCAAAGGTAGGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152463.1-1077s1c1
Sequence:CCGGGCACTATGAAAGGGAAGGAAACTCGAGTTTCCTTCCCTTTCATAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152463.1-485s1c1
Sequence:CCGGCCCTTTCCAAAGATCCCTGAACTCGAGTTCAGGGATCTTTGGAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_152463.1-1723s1c1
Sequence:CCGGCAGGCGTATCTACCTTCAGATCTCGAGATCTGAAGGTAGATACGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_152463.1-747s1c1
Sequence:CCGGCCCTGAGAAGACAGGAAAGAACTCGAGTTCTTTCCTGTCTTCTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_152463.1-1629s1c1
Sequence:CCGGCGGATAAAGAACGCCAGAATTCTCGAGAATTCTGGCGTTCTTTATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177752
VALIDATED
EME1 MISSION shRNA Bacterial Glycerol Stock
essential meiotic structure-specific endonuclease 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177752.4-1153s21c1
Sequence:CCGGGAAAGCATTGTCACTGGTGATCTCGAGATCACCAGTGACAATGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177752.4-541s21c1
Sequence:CCGGCTTAGAGAAGAGTGCTGCAAACTCGAGTTTGCAGCACTCTTCTCTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177752.4-942s21c1
Sequence:CCGGCCATACCTCGAAGCATCACTTCTCGAGAAGTGATGCTTCGAGGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177752.4-2016s21c1
Sequence:CCGGCCACTCAGACATGGATTTAATCTCGAGATTAAATCCATGTCTGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177752.2-2017s1c1
Sequence:CCGGCCACTCAGACATGGATTTAATCTCGAGATTAAATCCATGTCTGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177752.2-943s1c1
Sequence:CCGGCCATACCTCGAAGCATCACTTCTCGAGAAGTGATGCTTCGAGGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177752.2-542s1c1
Sequence:CCGGCTTAGAGAAGAGTGCTGCAAACTCGAGTTTGCAGCACTCTTCTCTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177752.2-1154s1c1
Sequence:CCGGGAAAGCATTGTCACTGGTGATCTCGAGATCACCAGTGACAATGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177752
VALIDATED
EME1 MISSION shRNA shRNA Plasmid DNA
essential meiotic structure-specific endonuclease 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177752.4-1153s21c1
Sequence:CCGGGAAAGCATTGTCACTGGTGATCTCGAGATCACCAGTGACAATGCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177752.4-541s21c1
Sequence:CCGGCTTAGAGAAGAGTGCTGCAAACTCGAGTTTGCAGCACTCTTCTCTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177752.4-942s21c1
Sequence:CCGGCCATACCTCGAAGCATCACTTCTCGAGAAGTGATGCTTCGAGGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177752.4-2016s21c1
Sequence:CCGGCCACTCAGACATGGATTTAATCTCGAGATTAAATCCATGTCTGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177752.2-2017s1c1
Sequence:CCGGCCACTCAGACATGGATTTAATCTCGAGATTAAATCCATGTCTGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177752.2-943s1c1
Sequence:CCGGCCATACCTCGAAGCATCACTTCTCGAGAAGTGATGCTTCGAGGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177752.2-542s1c1
Sequence:CCGGCTTAGAGAAGAGTGCTGCAAACTCGAGTTTGCAGCACTCTTCTCTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177752.2-1154s1c1
Sequence:CCGGGAAAGCATTGTCACTGGTGATCTCGAGATCACCAGTGACAATGCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177752
VALIDATED
EME1 MISSION shRNA Lentiviral Transduction Particles
essential meiotic structure-specific endonuclease 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177752.4-1153s21c1
Sequence:CCGGGAAAGCATTGTCACTGGTGATCTCGAGATCACCAGTGACAATGCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177752.4-541s21c1
Sequence:CCGGCTTAGAGAAGAGTGCTGCAAACTCGAGTTTGCAGCACTCTTCTCTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177752.4-942s21c1
Sequence:CCGGCCATACCTCGAAGCATCACTTCTCGAGAAGTGATGCTTCGAGGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177752.4-2016s21c1
Sequence:CCGGCCACTCAGACATGGATTTAATCTCGAGATTAAATCCATGTCTGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177752.2-2017s1c1
Sequence:CCGGCCACTCAGACATGGATTTAATCTCGAGATTAAATCCATGTCTGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177752.2-943s1c1
Sequence:CCGGCCATACCTCGAAGCATCACTTCTCGAGAAGTGATGCTTCGAGGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177752.2-542s1c1
Sequence:CCGGCTTAGAGAAGAGTGCTGCAAACTCGAGTTTGCAGCACTCTTCTCTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177752.2-1154s1c1
Sequence:CCGGGAAAGCATTGTCACTGGTGATCTCGAGATCACCAGTGACAATGCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)