EMAIL THIS PAGE TO A FRIEND

ENDOD1

endonuclease domain containing 1

78 Gene Product Result for
UniProtKB ID: O94919, Q6GQY5, Q8TAQ8
Gene ID:
Mouse(71946) endonuclease domain containing 1
Rat(363015) endonuclease domain containing 1
chicken(428090) endonuclease domain containing 1
dog(485119) endonuclease domain containing 1
domestic cat(101085151) endonuclease domain containing 1
cow(538618) endonuclease domain containing 1
Horse(100067528) endonuclease domain containing 1
naked mole-rat(101714570) endonuclease domain containing 1
domestic guinea pig(100721621) endonuclease domain containing 1
sheep(101102837) endonuclease domain containing 1
Domestic Rabbit(100355178) endonuclease domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028013 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028013 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028013 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015036 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015036 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015036 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015036 Rosetta Predictions human pricing
XM_290546 Rosetta Predictions human pricing
XM_934572 Rosetta Predictions human pricing
XR_006750 Rosetta Predictions rat pricing
XR_008933 Rosetta Predictions rat pricing
NM_028013 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015036 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346845 predicted 936
2 SASI_Hs02_00346846 predicted 1173
3 SASI_Hs02_00346847 predicted 1335
4 SASI_Hs02_00346848 predicted 1416
5 SASI_Hs02_00346849 predicted 862
6 SASI_Hs02_00346850 predicted 686
7 SASI_Hs02_00346851 predicted 1580
8 SASI_Hs02_00346852 predicted 1621
9 SASI_Hs02_00346853 predicted 845
10 SASI_Hs02_00346854 predicted 1600
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_290546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260323 predicted 983
2 SASI_Hs01_00260324 predicted 969
3 SASI_Hs01_00260325 predicted 1198
4 SASI_Hs01_00260326 predicted 1359
5 SASI_Hs01_00260327 predicted 1057
6 SASI_Hs01_00260328 predicted 892
7 SASI_Hs01_00260329 predicted 1094
8 SASI_Hs01_00260330 predicted 718
9 SASI_Hs01_00260331 predicted 714
10 SASI_Hs01_00260332 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934572 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289628 predicted 922
2 SASI_Hs01_00289629 predicted 898
3 SASI_Hs01_00289630 predicted 802
4 SASI_Hs01_00289631 predicted 900
5 SASI_Hs01_00289632 predicted 888
6 SASI_Hs01_00289633 predicted 896
7 SASI_Hs01_00289634 predicted 888
8 SASI_Hs01_00289635 predicted 867
9 SASI_Hs01_00289636 predicted 948
10 SASI_Hs01_00289637 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_006750 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00193776 predicted 2066
2 SASI_Rn01_00193777 predicted 2501
3 SASI_Rn01_00193778 predicted 1393
4 SASI_Rn01_00193779 predicted 3506
5 SASI_Rn01_00193780 predicted 3233
6 SASI_Rn01_00193781 predicted 2521
7 SASI_Rn01_00193782 predicted 825
8 SASI_Rn01_00193783 predicted 683
9 SASI_Rn01_00193784 predicted 3680
10 SASI_Rn02_00412758 predicted 2183
11 SASI_Rn01_00193785 predicted 3549
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008933 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00184608 predicted 2068
2 SASI_Rn01_00184609 predicted 2498
3 SASI_Rn01_00184610 predicted 1391
4 SASI_Rn01_00184611 predicted 3502
5 SASI_Rn01_00184612 predicted 3233
6 SASI_Rn01_00184613 predicted 2525
7 SASI_Rn01_00184614 predicted 820
8 SASI_Rn01_00184615 predicted 680
9 SASI_Rn01_00184616 predicted 3680
10 SASI_Rn02_00418264 predicted 2183
11 SASI_Rn01_00184617 predicted 3547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028013 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333129 predicted 1733
2 SASI_Mm01_00136703 predicted 991
3 SASI_Mm01_00136704 predicted 733
4 SASI_Mm01_00136705 predicted 666
5 SASI_Mm01_00136706 predicted 1316
6 SASI_Mm01_00136707 predicted 650
7 SASI_Mm01_00136708 predicted 1317
8 SASI_Mm01_00136709 predicted 848
9 SASI_Mm01_00136710 predicted 1379
10 SASI_Mm01_00136711 predicted 900
11 SASI_Mm01_00136702 predicted 1488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028013
ENDOD1 MISSION shRNA Bacterial Glycerol Stock
endonuclease domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028013.3-1744s21c1
Sequence:CCGGACAAGGTTACTTTAGACAATTCTCGAGAATTGTCTAAAGTAACCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028013.3-1385s21c1
Sequence:CCGGCACTGTTGAGAGTTGCCTATACTCGAGTATAGGCAACTCTCAACAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028013.3-674s21c1
Sequence:CCGGCATTGACTCTGACTATGAAATCTCGAGATTTCATAGTCAGAGTCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028013.3-1318s21c1
Sequence:CCGGACCTTGTTACAGCGGTCTTAACTCGAGTTAAGACCGCTGTAACAAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028013.1-3253s1c1
Sequence:CCGGCCAGGTATTCACAGGAGACATCTCGAGATGTCTCCTGTGAATACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028013.1-1487s1c1
Sequence:CCGGGATTGGGTACAAGGTTACTTTCTCGAGAAAGTAACCTTGTACCCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028013.1-499s1c1
Sequence:CCGGCGCTCACAAATTCAGTTCCAACTCGAGTTGGAACTGAATTTGTGAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028013.1-744s1c1
Sequence:CCGGCAGGACATTGATGTCATAGAACTCGAGTTCTATGACATCAATGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028013
ENDOD1 MISSION shRNA shRNA Plasmid DNA
endonuclease domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028013.3-1744s21c1
Sequence:CCGGACAAGGTTACTTTAGACAATTCTCGAGAATTGTCTAAAGTAACCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028013.3-1385s21c1
Sequence:CCGGCACTGTTGAGAGTTGCCTATACTCGAGTATAGGCAACTCTCAACAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028013.3-674s21c1
Sequence:CCGGCATTGACTCTGACTATGAAATCTCGAGATTTCATAGTCAGAGTCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028013.3-1318s21c1
Sequence:CCGGACCTTGTTACAGCGGTCTTAACTCGAGTTAAGACCGCTGTAACAAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028013.1-3253s1c1
Sequence:CCGGCCAGGTATTCACAGGAGACATCTCGAGATGTCTCCTGTGAATACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028013.1-1487s1c1
Sequence:CCGGGATTGGGTACAAGGTTACTTTCTCGAGAAAGTAACCTTGTACCCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028013.1-499s1c1
Sequence:CCGGCGCTCACAAATTCAGTTCCAACTCGAGTTGGAACTGAATTTGTGAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028013.1-744s1c1
Sequence:CCGGCAGGACATTGATGTCATAGAACTCGAGTTCTATGACATCAATGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028013
ENDOD1 MISSION shRNA Lentiviral Transduction Particles
endonuclease domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028013.3-1744s21c1
Sequence:CCGGACAAGGTTACTTTAGACAATTCTCGAGAATTGTCTAAAGTAACCTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028013.3-1385s21c1
Sequence:CCGGCACTGTTGAGAGTTGCCTATACTCGAGTATAGGCAACTCTCAACAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028013.3-674s21c1
Sequence:CCGGCATTGACTCTGACTATGAAATCTCGAGATTTCATAGTCAGAGTCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028013.3-1318s21c1
Sequence:CCGGACCTTGTTACAGCGGTCTTAACTCGAGTTAAGACCGCTGTAACAAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028013.1-3253s1c1
Sequence:CCGGCCAGGTATTCACAGGAGACATCTCGAGATGTCTCCTGTGAATACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028013.1-1487s1c1
Sequence:CCGGGATTGGGTACAAGGTTACTTTCTCGAGAAAGTAACCTTGTACCCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028013.1-499s1c1
Sequence:CCGGCGCTCACAAATTCAGTTCCAACTCGAGTTGGAACTGAATTTGTGAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028013.1-744s1c1
Sequence:CCGGCAGGACATTGATGTCATAGAACTCGAGTTCTATGACATCAATGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015036
VALIDATED
ENDOD1 MISSION shRNA Bacterial Glycerol Stock
endonuclease domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015036.1-393s21c1
Sequence:CCGGCAACCTTGAGGAGGCGATTAACTCGAGTTAATCGCCTCCTCAAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253687    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015036.1-3071s21c1
Sequence:CCGGAGCGTAGCAAGAGTTACATTTCTCGAGAAATGTAACTCTTGCTACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015036.1-1165s21c1
Sequence:CCGGGTTACCAAGCAGGTGATTAATCTCGAGATTAATCACCTGCTTGGTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015036.1-1399s21c1
Sequence:CCGGGTGTACACCATGGGCGCTATTCTCGAGAATAGCGCCCATGGTGTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015036.1-948s21c1
Sequence:CCGGTGAAGAACGAATGGTACAATCCTCGAGGATTGTACCATTCGTTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015036
VALIDATED
ENDOD1 MISSION shRNA shRNA Plasmid DNA
endonuclease domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015036.1-393s21c1
Sequence:CCGGCAACCTTGAGGAGGCGATTAACTCGAGTTAATCGCCTCCTCAAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253687    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015036.1-3071s21c1
Sequence:CCGGAGCGTAGCAAGAGTTACATTTCTCGAGAAATGTAACTCTTGCTACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015036.1-1165s21c1
Sequence:CCGGGTTACCAAGCAGGTGATTAATCTCGAGATTAATCACCTGCTTGGTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015036.1-1399s21c1
Sequence:CCGGGTGTACACCATGGGCGCTATTCTCGAGAATAGCGCCCATGGTGTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015036.1-948s21c1
Sequence:CCGGTGAAGAACGAATGGTACAATCCTCGAGGATTGTACCATTCGTTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015036
VALIDATED
ENDOD1 MISSION shRNA Lentiviral Transduction Particles
endonuclease domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015036.1-393s21c1
Sequence:CCGGCAACCTTGAGGAGGCGATTAACTCGAGTTAATCGCCTCCTCAAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253687    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015036.1-3071s21c1
Sequence:CCGGAGCGTAGCAAGAGTTACATTTCTCGAGAAATGTAACTCTTGCTACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015036.1-1165s21c1
Sequence:CCGGGTTACCAAGCAGGTGATTAATCTCGAGATTAATCACCTGCTTGGTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015036.1-1399s21c1
Sequence:CCGGGTGTACACCATGGGCGCTATTCTCGAGAATAGCGCCCATGGTGTACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015036.1-948s21c1
Sequence:CCGGTGAAGAACGAATGGTACAATCCTCGAGGATTGTACCATTCGTTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)