EMAIL THIS PAGE TO A FRIEND

Epb4.1l2

15 Gene Product Result for
Species: Mouse Epb4.1l2(13822)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013511 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013511 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013511 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU180681 MISSION® esiRNA targeting mouse Epb4.1l2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013511 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013511 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322179 predicted 1568
2 SASI_Mm01_00124289 predicted 336
3 SASI_Mm01_00124290 predicted 1400
4 SASI_Mm01_00124293 predicted 344
5 SASI_Mm01_00124295 predicted 986
6 SASI_Mm02_00322180 predicted 1987
7 SASI_Mm01_00124296 predicted 826
8 SASI_Mm01_00124297 predicted 732
9 SASI_Mm02_00322181 predicted 2587
10 SASI_Mm02_00322182 predicted 1654
11 SASI_Mm01_00124291 predicted 1908
12 SASI_Mm01_00124292 predicted 1173
13 SASI_Mm01_00124294 predicted 2727
14 SASI_Mm01_00124298 predicted 1280
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013511
VALIDATED
Epb4.1l2 MISSION shRNA Bacterial Glycerol Stock
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013511.1-2533s1c1
Sequence:CCGGCCAGAGATTATTTGTTGTTCACTCGAGTGAACAACAAATAATCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013511.1-1332s1c1
Sequence:CCGGGCGCAGTAATTTCTACATTAACTCGAGTTAATGTAGAAATTACTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013511.1-1027s1c1
Sequence:CCGGCCAGAAGAATATGACAGTATTCTCGAGAATACTGTCATATTCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013511.1-1149s1c1
Sequence:CCGGCGACTCTCAGTTCTTAGAGAACTCGAGTTCTCTAAGAACTGAGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013511.1-691s1c1
Sequence:CCGGGCCAAGGGACAAGTGTTGTTTCTCGAGAAACAACACTTGTCCCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013511.2-1679s21c1
Sequence:CCGGTTTGAGCGTGCCTCTAGTAAACTCGAGTTTACTAGAGGCACGCTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013511.2-2618s21c1
Sequence:CCGGCCAGAGATTATTTGTTGTTCACTCGAGTGAACAACAAATAATCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013511.2-1234s21c1
Sequence:CCGGCGACTCTCAGTTCTTAGAGAACTCGAGTTCTCTAAGAACTGAGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013511.2-3456s21c1
Sequence:CCGGAGGAAACTCGTGACTAATTTACTCGAGTAAATTAGTCACGAGTTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013511
VALIDATED
Epb4.1l2 MISSION shRNA shRNA Plasmid DNA
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013511.1-2533s1c1
Sequence:CCGGCCAGAGATTATTTGTTGTTCACTCGAGTGAACAACAAATAATCTCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000091203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013511.1-1332s1c1
Sequence:CCGGGCGCAGTAATTTCTACATTAACTCGAGTTAATGTAGAAATTACTGCGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000091204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013511.1-1027s1c1
Sequence:CCGGCCAGAAGAATATGACAGTATTCTCGAGAATACTGTCATATTCTTCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000091206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013511.1-1149s1c1
Sequence:CCGGCGACTCTCAGTTCTTAGAGAACTCGAGTTCTCTAAGAACTGAGAGTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000091205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013511.1-691s1c1
Sequence:CCGGGCCAAGGGACAAGTGTTGTTTCTCGAGAAACAACACTTGTCCCTTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000375456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013511.2-1679s21c1
Sequence:CCGGTTTGAGCGTGCCTCTAGTAAACTCGAGTTTACTAGAGGCACGCTCAAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000327183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013511.2-2618s21c1
Sequence:CCGGCCAGAGATTATTTGTTGTTCACTCGAGTGAACAACAAATAATCTCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000327110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013511.2-1234s21c1
Sequence:CCGGCGACTCTCAGTTCTTAGAGAACTCGAGTTCTCTAAGAACTGAGAGTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000306581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013511.2-3456s21c1
Sequence:CCGGAGGAAACTCGTGACTAATTTACTCGAGTAAATTAGTCACGAGTTTCCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013511
VALIDATED
Epb4.1l2 MISSION shRNA Lentiviral Transduction Particles
Mouse
9 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000091207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013511.1-2533s1c1
Sequence:CCGGCCAGAGATTATTTGTTGTTCACTCGAGTGAACAACAAATAATCTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013511.1-1332s1c1
Sequence:CCGGGCGCAGTAATTTCTACATTAACTCGAGTTAATGTAGAAATTACTGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013511.1-1027s1c1
Sequence:CCGGCCAGAAGAATATGACAGTATTCTCGAGAATACTGTCATATTCTTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013511.1-1149s1c1
Sequence:CCGGCGACTCTCAGTTCTTAGAGAACTCGAGTTCTCTAAGAACTGAGAGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013511.1-691s1c1
Sequence:CCGGGCCAAGGGACAAGTGTTGTTTCTCGAGAAACAACACTTGTCCCTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013511.2-1679s21c1
Sequence:CCGGTTTGAGCGTGCCTCTAGTAAACTCGAGTTTACTAGAGGCACGCTCAAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013511.2-2618s21c1
Sequence:CCGGCCAGAGATTATTTGTTGTTCACTCGAGTGAACAACAAATAATCTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013511.2-1234s21c1
Sequence:CCGGCGACTCTCAGTTCTTAGAGAACTCGAGTTCTCTAAGAACTGAGAGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013511.2-3456s21c1
Sequence:CCGGAGGAAACTCGTGACTAATTTACTCGAGTAAATTAGTCACGAGTTTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)