EMAIL THIS PAGE TO A FRIEND

EPB41L5

erythrocyte membrane protein band 4.1 like 5

108 Gene Product Result for
Synonyms: BE37 YMO1
UniProtKB ID: Q9HCM4, Q7Z5S1, Q8IZ12, Q9H975
Gene ID:
Goat(100861273) erythrocyte membrane protein band 4.1 like 5
Domestic Rabbit(100349234) erythrocyte membrane protein band 4.1 like 5
sheep(101112882) erythrocyte membrane protein band 4.1 like 5
domestic guinea pig(100719000) erythrocyte membrane protein band 4.1 like 5
naked mole-rat(101700951) erythrocyte membrane protein band 4.1 like 5
Zebrafish(368449) erythrocyte membrane protein band 4.1 like 5
domestic cat(101081240) erythrocyte membrane protein band 4.1 like 5
Horse(100060271) erythrocyte membrane protein band 4.1 like 5
cow(530941) erythrocyte membrane protein band 4.1 like 5
dog(403419) erythrocyte membrane protein band 4.1 like 5
chicken(424235) erythrocyte membrane protein band 4.1 like 5
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020909 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020909 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020909 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086691 MISSION® esiRNA esiRNA human EPB41L5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020909 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056160 predicted 849
2 SASI_Hs01_00056161 predicted 1798
3 SASI_Hs01_00056162 predicted 1047
4 SASI_Hs01_00056163 predicted 2391
5 SASI_Hs02_00354254 predicted 552
6 SASI_Hs02_00354255 predicted 1637
7 SASI_Hs01_00056164 predicted 1752
8 SASI_Hs01_00056165 predicted 636
9 SASI_Hs01_00056167 predicted 1016
10 SASI_Hs01_00056168 predicted 1950
11 SASI_Hs01_00056166 predicted 773
12 SASI_Hs01_00056169 predicted 1693
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020909
EPB41L5 MISSION shRNA Bacterial Glycerol Stock
erythrocyte membrane protein band 4.1 like 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020909.2-313s1c1
Sequence:CCGGGCCAAAGGACAAGAGTTGTTTCTCGAGAAACAACTCTTGTCCTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020909.2-4479s1c1
Sequence:CCGGCCGACAGATTAAATGCGTGTTCTCGAGAACACGCATTTAATCTGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020909.2-2044s1c1
Sequence:CCGGGCATCTCTAACTGAGAATCTACTCGAGTAGATTCTCAGTTAGAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020909.2-1129s1c1
Sequence:CCGGCGATCAGGATTTATTCGACTACTCGAGTAGTCGAATAAATCCTGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020909.2-1133s1c1
Sequence:CCGGCAGGATTTATTCGACTAGGATCTCGAGATCCTAGTCGAATAAATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146871    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020909.2-6059s1c1
Sequence:CCGGCCTACATATTAGGCGTTAGTACTCGAGTACTAACGCCTAATATGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020909.2-2973s1c1
Sequence:CCGGCCTGAGAAGAACTACGGAGAACTCGAGTTCTCCGTAGTTCTTCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020909.2-1561s1c1
Sequence:CCGGGCACTGAATGACGTTAATGTACTCGAGTACATTAACGTCATTCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020909.2-1493s1c1
Sequence:CCGGGCCCAGACTTATTGGAAGCAACTCGAGTTGCTTCCAATAAGTCTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020909.2-3365s1c1
Sequence:CCGGCCTACCATGTATGAAGCTATACTCGAGTATAGCTTCATACATGGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020909
EPB41L5 MISSION shRNA shRNA Plasmid DNA
erythrocyte membrane protein band 4.1 like 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020909.2-313s1c1
Sequence:CCGGGCCAAAGGACAAGAGTTGTTTCTCGAGAAACAACTCTTGTCCTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020909.2-4479s1c1
Sequence:CCGGCCGACAGATTAAATGCGTGTTCTCGAGAACACGCATTTAATCTGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020909.2-2044s1c1
Sequence:CCGGGCATCTCTAACTGAGAATCTACTCGAGTAGATTCTCAGTTAGAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020909.2-1129s1c1
Sequence:CCGGCGATCAGGATTTATTCGACTACTCGAGTAGTCGAATAAATCCTGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020909.2-1133s1c1
Sequence:CCGGCAGGATTTATTCGACTAGGATCTCGAGATCCTAGTCGAATAAATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146871    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020909.2-6059s1c1
Sequence:CCGGCCTACATATTAGGCGTTAGTACTCGAGTACTAACGCCTAATATGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020909.2-2973s1c1
Sequence:CCGGCCTGAGAAGAACTACGGAGAACTCGAGTTCTCCGTAGTTCTTCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020909.2-1561s1c1
Sequence:CCGGGCACTGAATGACGTTAATGTACTCGAGTACATTAACGTCATTCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020909.2-1493s1c1
Sequence:CCGGGCCCAGACTTATTGGAAGCAACTCGAGTTGCTTCCAATAAGTCTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020909.2-3365s1c1
Sequence:CCGGCCTACCATGTATGAAGCTATACTCGAGTATAGCTTCATACATGGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020909
EPB41L5 MISSION shRNA Lentiviral Transduction Particles
erythrocyte membrane protein band 4.1 like 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020909.2-313s1c1
Sequence:CCGGGCCAAAGGACAAGAGTTGTTTCTCGAGAAACAACTCTTGTCCTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020909.2-4479s1c1
Sequence:CCGGCCGACAGATTAAATGCGTGTTCTCGAGAACACGCATTTAATCTGTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020909.2-2044s1c1
Sequence:CCGGGCATCTCTAACTGAGAATCTACTCGAGTAGATTCTCAGTTAGAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020909.2-1129s1c1
Sequence:CCGGCGATCAGGATTTATTCGACTACTCGAGTAGTCGAATAAATCCTGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020909.2-1133s1c1
Sequence:CCGGCAGGATTTATTCGACTAGGATCTCGAGATCCTAGTCGAATAAATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146871    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020909.2-6059s1c1
Sequence:CCGGCCTACATATTAGGCGTTAGTACTCGAGTACTAACGCCTAATATGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020909.2-2973s1c1
Sequence:CCGGCCTGAGAAGAACTACGGAGAACTCGAGTTCTCCGTAGTTCTTCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020909.2-1561s1c1
Sequence:CCGGGCACTGAATGACGTTAATGTACTCGAGTACATTAACGTCATTCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020909.2-1493s1c1
Sequence:CCGGGCCCAGACTTATTGGAAGCAACTCGAGTTGCTTCCAATAAGTCTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020909.2-3365s1c1
Sequence:CCGGCCTACCATGTATGAAGCTATACTCGAGTATAGCTTCATACATGGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)