EMAIL THIS PAGE TO A FRIEND

EPHA4

EPH receptor A4

165 Gene Product Result for
Synonyms: HEK8 SEK TYRO1
UniProtKB ID: P54764, Q2M380
Gene ID:
Human(2043) Summary: This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. [provided by RefSeq, Jul 2008]
Mouse(13838) Eph receptor A4
Rat(316539) Eph receptor A4
chicken(395559) EPH receptor A4
dog(478925) EPH receptor A4
cow(520192) EPH receptor A4
Horse(100060325) EPH receptor A4
domestic cat(101081155) EPH receptor A4
sheep(101118852) EPH receptor A4
Domestic Rabbit(100357064) EPH receptor A4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2900054 Anti-EPHA4 (AB1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution hamster, mouse, rabbit, bovine, monkey, rat, human, dog, pig, horse
ELISA, immunohistochemistry pricing
SAB2900055 Anti-EPHA4 (AB2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
E6900 Anti-EphA4 antibody produced in goat affinity isolated antibody, lyophilized powder mouse
ELISA, western blot pricing
SAB2107644 Anti-EPHA4 antibody produced in rabbit affinity isolated antibody mouse, horse, guinea pig, human, rabbit
ELISA, western blot pricing
SAB1304739 ANTI-MOUSE EPHA4 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4504171 Anti-phospho-EPHA2/3 (pTyr588/596) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, western blot pricing
SAB4301391 Anti-phospho-EPHA4 (pTyr596) antibody produced in rabbit affinity isolated antibody human
western blot pricing
WH0002043M2 Monoclonal Anti-EPHA4 antibody produced in mouse clone 6H7, purified immunoglobulin, buffered aqueous solution mouse
ELISA, western blot pricing
SAB5300482 Monoclonal Anti-EPHA4 antibody produced in mouse clone 7D3D4, ascites fluid human
ELISA, western blot pricing
SAB5300483 Monoclonal Anti-EPHA4 antibody produced in mouse clone 6C1B6, ascites fluid human
ELISA, western blot pricing
SAB1403778 Monoclonal Anti-EPHA4, (C-terminal) antibody produced in mouse clone 5A9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB0953 Phosphotyrosine EPHA4 / Ephrin Type-A Receptor 4 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004438 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004438 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004438 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007936 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007936 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007936 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041471 MISSION® esiRNA esiRNA human EPHA4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004438 Rosetta Predictions human pricing
XM_244186 Rosetta Predictions rat pricing
XR_007714 Rosetta Predictions rat pricing
NM_007936 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085623 predicted 2811
2 SASI_Hs01_00085624 predicted 2106
3 SASI_Hs01_00085625 predicted 2058
4 SASI_Hs01_00085626 predicted 290
5 SASI_Hs01_00085627 predicted 1913
6 SASI_Hs01_00085628 predicted 1775
7 SASI_Hs01_00085629 predicted 792
8 SASI_Hs01_00085630 predicted 360
9 SASI_Hs02_00337610 predicted 616
10 SASI_Hs01_00085631 predicted 1841
11 SASI_Hs01_00085632 predicted 2429
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_244186 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391819 predicted 2831
2 SASI_Rn02_00391820 predicted 1562
3 SASI_Rn02_00391821 predicted 1302
4 SASI_Rn02_00391822 predicted 2867
5 SASI_Rn02_00391823 predicted 2119
6 SASI_Rn02_00391824 predicted 1391
7 SASI_Rn02_00391825 predicted 415
8 SASI_Rn02_00391826 predicted 2192
9 SASI_Rn02_00391827 predicted 1133
10 SASI_Rn02_00391828 predicted 1924
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007714 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00172456 predicted 5043
2 SASI_Rn01_00172458 predicted 3557
3 SASI_Rn01_00172459 predicted 1565
4 SASI_Rn01_00172460 predicted 5829
5 SASI_Rn02_00415286 predicted 2870
6 SASI_Rn01_00172461 predicted 2115
7 SASI_Rn01_00172462 predicted 1392
8 SASI_Rn02_00415287 predicted 417
9 SASI_Rn01_00172463 predicted 1136
10 SASI_Rn01_00172464 predicted 1926
11 SASI_Rn01_00172455 predicted 3933
12 SASI_Rn01_00172457 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007936 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057481 predicted 1301
2 SASI_Mm01_00057482 predicted 1832
3 SASI_Mm02_00312775 predicted 1927
4 SASI_Mm01_00057483 predicted 1284
5 SASI_Mm01_00057484 predicted 2645
6 SASI_Mm01_00057485 predicted 1310
7 SASI_Mm01_00057486 predicted 2431
8 SASI_Mm01_00057487 predicted 1135
9 SASI_Mm01_00057488 predicted 341
10 SASI_Mm01_00057489 predicted 1399
11 SASI_Mm01_00057490 predicted 2203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004438
VALIDATED
EPHA4 MISSION shRNA Bacterial Glycerol Stock
EPH receptor A4
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004438.3-2425s21c1
Sequence:GTACCGGGCAATTGCCTATCGTAAATTCCTCGAGGAATTTACGATAGGCAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004438.3-1493s21c1
Sequence:GTACCGGATGAGCGAAGCTATCGTATAGCTCGAGCTATACGATAGCTTCGCTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220022    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004438.3-4882s1c1
Sequence:CCGGGTTGAATGCGAACGAATATATCTCGAGATATATTCGTTCGCATTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004438.3-2794s1c1
Sequence:CCGGGATTGGCTCCAGGCCATTAAACTCGAGTTTAATGGCCTGGAGCCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_004438.3-2794s21c1
Sequence:CCGGGATTGGCTCCAGGCCATTAAACTCGAGTTTAATGGCCTGGAGCCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004438.3-1747s21c1
Sequence:CCGGATCAGCCGGAGACGGAGTAAACTCGAGTTTACTCCGTCTCCGGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004438.3-628s21c1
Sequence:CCGGTCAGTCCGTGTGTTCTATAAACTCGAGTTTATAGAACACACGGACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_004438.3-390s21c1
Sequence:CCGGGACTTGCAAGGAGACGTTTAACTCGAGTTAAACGTCTCCTTGCAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004438.3-390s1c1
Sequence:CCGGGACTTGCAAGGAGACGTTTAACTCGAGTTAAACGTCTCCTTGCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004438.3-2528s1c1
Sequence:CCGGCCAATCAAGATGTGATTAAAGCTCGAGCTTTAATCACATCTTGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195102    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004438.3-5985s1c1
Sequence:CCGGCACTGAAGAGTGCGTTTATTTCTCGAGAAATAAACGCACTCTTCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004438.x-1516s1c1
Sequence:CCGGGCCAGGAACACAGATATCAAACTCGAGTTTGATATCTGTGTTCCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004438.x-1344s1c1
Sequence:CCGGCCAAGCAGCACCATCATCCATCTCGAGATGGATGATGGTGCTGCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004438.x-2224s1c1
Sequence:CCGGGGGTCTGGGATGAAGTATTTACTCGAGTAAATACTTCATCCCAGACCCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004438.x-619s1c1
Sequence:CCGGTCAGTCCGTGTGTTCTATAAACTCGAGTTTATAGAACACACGGACTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004438
VALIDATED
EPHA4 MISSION shRNA shRNA Plasmid DNA
EPH receptor A4
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004438.3-2425s21c1
Sequence:GTACCGGGCAATTGCCTATCGTAAATTCCTCGAGGAATTTACGATAGGCAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004438.3-1493s21c1
Sequence:GTACCGGATGAGCGAAGCTATCGTATAGCTCGAGCTATACGATAGCTTCGCTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220022    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004438.3-4882s1c1
Sequence:CCGGGTTGAATGCGAACGAATATATCTCGAGATATATTCGTTCGCATTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004438.3-2794s1c1
Sequence:CCGGGATTGGCTCCAGGCCATTAAACTCGAGTTTAATGGCCTGGAGCCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_004438.3-2794s21c1
Sequence:CCGGGATTGGCTCCAGGCCATTAAACTCGAGTTTAATGGCCTGGAGCCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004438.3-1747s21c1
Sequence:CCGGATCAGCCGGAGACGGAGTAAACTCGAGTTTACTCCGTCTCCGGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004438.3-628s21c1
Sequence:CCGGTCAGTCCGTGTGTTCTATAAACTCGAGTTTATAGAACACACGGACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_004438.3-390s21c1
Sequence:CCGGGACTTGCAAGGAGACGTTTAACTCGAGTTAAACGTCTCCTTGCAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004438.3-390s1c1
Sequence:CCGGGACTTGCAAGGAGACGTTTAACTCGAGTTAAACGTCTCCTTGCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004438.3-2528s1c1
Sequence:CCGGCCAATCAAGATGTGATTAAAGCTCGAGCTTTAATCACATCTTGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195102    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004438.3-5985s1c1
Sequence:CCGGCACTGAAGAGTGCGTTTATTTCTCGAGAAATAAACGCACTCTTCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004438.x-1516s1c1
Sequence:CCGGGCCAGGAACACAGATATCAAACTCGAGTTTGATATCTGTGTTCCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004438.x-1344s1c1
Sequence:CCGGCCAAGCAGCACCATCATCCATCTCGAGATGGATGATGGTGCTGCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004438.x-2224s1c1
Sequence:CCGGGGGTCTGGGATGAAGTATTTACTCGAGTAAATACTTCATCCCAGACCCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004438.x-619s1c1
Sequence:CCGGTCAGTCCGTGTGTTCTATAAACTCGAGTTTATAGAACACACGGACTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004438
VALIDATED
EPHA4 MISSION shRNA Lentiviral Transduction Particles
EPH receptor A4
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004438.3-2425s21c1
Sequence:GTACCGGGCAATTGCCTATCGTAAATTCCTCGAGGAATTTACGATAGGCAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004438.3-1493s21c1
Sequence:GTACCGGATGAGCGAAGCTATCGTATAGCTCGAGCTATACGATAGCTTCGCTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220022    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004438.3-4882s1c1
Sequence:CCGGGTTGAATGCGAACGAATATATCTCGAGATATATTCGTTCGCATTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004438.3-2794s1c1
Sequence:CCGGGATTGGCTCCAGGCCATTAAACTCGAGTTTAATGGCCTGGAGCCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_004438.3-2794s21c1
Sequence:CCGGGATTGGCTCCAGGCCATTAAACTCGAGTTTAATGGCCTGGAGCCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004438.3-1747s21c1
Sequence:CCGGATCAGCCGGAGACGGAGTAAACTCGAGTTTACTCCGTCTCCGGCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004438.3-628s21c1
Sequence:CCGGTCAGTCCGTGTGTTCTATAAACTCGAGTTTATAGAACACACGGACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_004438.3-390s21c1
Sequence:CCGGGACTTGCAAGGAGACGTTTAACTCGAGTTAAACGTCTCCTTGCAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004438.3-390s1c1
Sequence:CCGGGACTTGCAAGGAGACGTTTAACTCGAGTTAAACGTCTCCTTGCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004438.3-2528s1c1
Sequence:CCGGCCAATCAAGATGTGATTAAAGCTCGAGCTTTAATCACATCTTGATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195102    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004438.3-5985s1c1
Sequence:CCGGCACTGAAGAGTGCGTTTATTTCTCGAGAAATAAACGCACTCTTCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004438.x-1516s1c1
Sequence:CCGGGCCAGGAACACAGATATCAAACTCGAGTTTGATATCTGTGTTCCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004438.x-1344s1c1
Sequence:CCGGCCAAGCAGCACCATCATCCATCTCGAGATGGATGATGGTGCTGCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004438.x-2224s1c1
Sequence:CCGGGGGTCTGGGATGAAGTATTTACTCGAGTAAATACTTCATCCCAGACCCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004438.x-619s1c1
Sequence:CCGGTCAGTCCGTGTGTTCTATAAACTCGAGTTTATAGAACACACGGACTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007936
EPHA4 MISSION shRNA Bacterial Glycerol Stock
EPH receptor A4
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007936.3-1903s21c1
Sequence:CCGGATCGATGCATCCTGCATTAAACTCGAGTTTAATGCAGGATGCATCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007936.3-1762s21c1
Sequence:CCGGATCAGCCGAAGACGGAGTAAGCTCGAGCTTACTCCGTCTTCGGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007936.3-3490s21c1
Sequence:CCGGGCTTTCAGGGCTCGGTTTATACTCGAGTATAAACCGAGCCCTGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007936.3-3232s21c1
Sequence:CCGGTAAACCTGGAGCCAGTAATTTCTCGAGAAATTACTGGCTCCAGGTTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007936.3-2132s21c1
Sequence:CCGGGTAAACCGGTAATGATCATAACTCGAGTTATGATCATTACCGGTTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007936.3-2440s21c1
Sequence:CCGGGCAATTGCGTATCGTAAATTTCTCGAGAAATTTACGATACGCAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007936.3-1304s21c1
Sequence:CCGGTGAATGGAGTGTCTAAGTATACTCGAGTATACTTAGACACTCCATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007936.3-2650s21c1
Sequence:CCGGAGAAGTGACAGGCCTAAATTTCTCGAGAAATTTAGGCCTGTCACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007936.2-1242s1c1
Sequence:CCGGGCACACACCAATTACACGTTTCTCGAGAAACGTGTAATTGGTGTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007936.2-552s1c1
Sequence:CCGGCCACTGAGCAAGAAAGGGTTTCTCGAGAAACCCTTTCTTGCTCAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007936.2-1425s1c1
Sequence:CCGGCGACCAAATGGAGTCATCTTACTCGAGTAAGATGACTCCATTTGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007936.2-108s1c1
Sequence:CCGGCCCGCGAATGAAGTTACTTTACTCGAGTAAAGTAACTTCATTCGCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007936.2-1609s1c1
Sequence:CCGGCCCTGGAAGTCACTACTAATACTCGAGTATTAGTAGTGACTTCCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007936
EPHA4 MISSION shRNA shRNA Plasmid DNA
EPH receptor A4
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007936.3-1903s21c1
Sequence:CCGGATCGATGCATCCTGCATTAAACTCGAGTTTAATGCAGGATGCATCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007936.3-1762s21c1
Sequence:CCGGATCAGCCGAAGACGGAGTAAGCTCGAGCTTACTCCGTCTTCGGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007936.3-3490s21c1
Sequence:CCGGGCTTTCAGGGCTCGGTTTATACTCGAGTATAAACCGAGCCCTGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007936.3-3232s21c1
Sequence:CCGGTAAACCTGGAGCCAGTAATTTCTCGAGAAATTACTGGCTCCAGGTTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007936.3-2132s21c1
Sequence:CCGGGTAAACCGGTAATGATCATAACTCGAGTTATGATCATTACCGGTTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007936.3-2440s21c1
Sequence:CCGGGCAATTGCGTATCGTAAATTTCTCGAGAAATTTACGATACGCAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007936.3-1304s21c1
Sequence:CCGGTGAATGGAGTGTCTAAGTATACTCGAGTATACTTAGACACTCCATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007936.3-2650s21c1
Sequence:CCGGAGAAGTGACAGGCCTAAATTTCTCGAGAAATTTAGGCCTGTCACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007936.2-1242s1c1
Sequence:CCGGGCACACACCAATTACACGTTTCTCGAGAAACGTGTAATTGGTGTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007936.2-552s1c1
Sequence:CCGGCCACTGAGCAAGAAAGGGTTTCTCGAGAAACCCTTTCTTGCTCAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007936.2-1425s1c1
Sequence:CCGGCGACCAAATGGAGTCATCTTACTCGAGTAAGATGACTCCATTTGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007936.2-108s1c1
Sequence:CCGGCCCGCGAATGAAGTTACTTTACTCGAGTAAAGTAACTTCATTCGCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007936.2-1609s1c1
Sequence:CCGGCCCTGGAAGTCACTACTAATACTCGAGTATTAGTAGTGACTTCCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007936
EPHA4 MISSION shRNA Lentiviral Transduction Particles
EPH receptor A4
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007936.3-1903s21c1
Sequence:CCGGATCGATGCATCCTGCATTAAACTCGAGTTTAATGCAGGATGCATCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007936.3-1762s21c1
Sequence:CCGGATCAGCCGAAGACGGAGTAAGCTCGAGCTTACTCCGTCTTCGGCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007936.3-3490s21c1
Sequence:CCGGGCTTTCAGGGCTCGGTTTATACTCGAGTATAAACCGAGCCCTGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007936.3-3232s21c1
Sequence:CCGGTAAACCTGGAGCCAGTAATTTCTCGAGAAATTACTGGCTCCAGGTTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007936.3-2132s21c1
Sequence:CCGGGTAAACCGGTAATGATCATAACTCGAGTTATGATCATTACCGGTTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007936.3-2440s21c1
Sequence:CCGGGCAATTGCGTATCGTAAATTTCTCGAGAAATTTACGATACGCAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007936.3-1304s21c1
Sequence:CCGGTGAATGGAGTGTCTAAGTATACTCGAGTATACTTAGACACTCCATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007936.3-2650s21c1
Sequence:CCGGAGAAGTGACAGGCCTAAATTTCTCGAGAAATTTAGGCCTGTCACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007936.2-1242s1c1
Sequence:CCGGGCACACACCAATTACACGTTTCTCGAGAAACGTGTAATTGGTGTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007936.2-552s1c1
Sequence:CCGGCCACTGAGCAAGAAAGGGTTTCTCGAGAAACCCTTTCTTGCTCAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007936.2-1425s1c1
Sequence:CCGGCGACCAAATGGAGTCATCTTACTCGAGTAAGATGACTCCATTTGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007936.2-108s1c1
Sequence:CCGGCCCGCGAATGAAGTTACTTTACTCGAGTAAAGTAACTTCATTCGCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007936.2-1609s1c1
Sequence:CCGGCCCTGGAAGTCACTACTAATACTCGAGTATTAGTAGTGACTTCCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)