EMAIL THIS PAGE TO A FRIEND

EPHB2

EPH receptor B2

182 Gene Product Result for
Synonyms: CAPB DRT EK5 EPHT3 ERK Hek5 PCBC Tyro5
UniProtKB ID: P29323, O43477, Q5T0U6, Q5T0U7, Q5T0U8
Gene ID:
Human(2048) Summary: Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene is a receptor for ephrin-B family members. [provided by RefSeq, Jul 2008]
Mouse(13844) Eph receptor B2
Rat(313633) Eph receptor B2
naked mole-rat(101705033) EPH receptor B2
sheep(101122928) EPH receptor B2
Zebrafish(562176) EPH receptor B2
chicken(396513) EPH receptor B2
Horse(100071661) EPH receptor B2
cow(535137) EPH receptor B2
domestic cat(101095030) EPH receptor B2
dog(487380) EPH receptor B2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0950 Phosphotyrosine EPHB2 / Ephrin Type-B Receptor 2 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004442 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004442 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004442 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010142 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010142 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010142 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004442 Rosetta Predictions human pricing
NM_017449 Rosetta Predictions human pricing
NM_001127319 Rosetta Predictions rat pricing
NM_010142 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145268 predicted 2225
2 SASI_Hs02_00337618 predicted 2083
3 SASI_Hs01_00145269 predicted 1409
4 SASI_Hs01_00145271 predicted 468
5 SASI_Hs01_00145272 predicted 1544
6 SASI_Hs01_00145274 predicted 2432
7 SASI_Hs02_00337619 predicted 1132
8 SASI_Hs02_00337620 predicted 2963
9 SASI_Hs01_00145275 predicted 2762
10 SASI_Hs02_00337621 predicted 2980
11 SASI_Hs01_00145270 predicted 359
12 SASI_Hs01_00145273 predicted 1243
13 SASI_Hs01_00145276 predicted 838
14 SASI_Hs01_00145277 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230158 predicted 2219
2 SASI_Hs02_00350064 predicted 2078
3 SASI_Hs01_00230159 predicted 1403
4 SASI_Hs01_00230161 predicted 474
5 SASI_Hs01_00230162 predicted 1546
6 SASI_Hs01_00230164 predicted 2426
7 SASI_Hs02_00350065 predicted 1130
8 SASI_Hs02_00350066 predicted 2964
9 SASI_Hs01_00230165 predicted 2762
10 SASI_Hs02_00350067 predicted 2975
11 SASI_Hs01_00230160 predicted 349
12 SASI_Hs01_00230163 predicted 1250
13 SASI_Hs01_00230166 predicted 838
14 SASI_Hs01_00230167 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127319 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253613 predicted 1399
2 SASI_Rn02_00253614 predicted 1930
3 SASI_Rn02_00253615 predicted 1698
4 SASI_Rn02_00253616 predicted 1672
5 SASI_Rn02_00253617 predicted 1198
6 SASI_Rn02_00253618 predicted 2484
7 SASI_Rn02_00253619 predicted 943
8 SASI_Rn02_00253620 predicted 2690
9 SASI_Rn02_00253621 predicted 332
10 SASI_Rn02_00253622 predicted 2727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010142 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087600 predicted 1360
2 SASI_Mm02_00317883 predicted 2837
3 SASI_Mm01_00087601 predicted 2941
4 SASI_Mm01_00087602 predicted 2917
5 SASI_Mm01_00087603 predicted 1003
6 SASI_Mm01_00087604 predicted 2350
7 SASI_Mm01_00087605 predicted 2922
8 SASI_Mm01_00087606 predicted 1780
9 SASI_Mm01_00087607 predicted 2916
10 SASI_Mm01_00087608 predicted 3025
11 SASI_Mm01_00087609 predicted 2611
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004442
VALIDATED
EPHB2 MISSION shRNA Bacterial Glycerol Stock
EPH receptor B2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004442.6-2988s21c1
Sequence:CCGGAGATGATGATGGAGGACATTCCTCGAGGAATGTCCTCCATCATCATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004442.6-2452s21c1
Sequence:CCGGACGCTTTCTAGAGGACGATACCTCGAGGTATCGTCCTCTAGAAAGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004442.6-472s21c1
Sequence:CCGGGACCTTCAACCTCTATTACTACTCGAGTAGTAATAGAGGTTGAAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004442.6-3359s21c1
Sequence:CCGGTTTAAAGAGGATTCTCATAAGCTCGAGCTTATGAGAATCCTCTTTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004442.6-3337s21c1
Sequence:CCGGGCGGGAAATACAAGGAATATTCTCGAGAATATTCCTTGTATTTCCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004442.6-851s21c1
Sequence:CCGGCCCATCAAGCTCTACTGTAACCTCGAGGTTACAGTAGAGCTTGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_004442.6-715s1c1
Sequence:CCGGGCGTGTCTTCTACCGCAAGTGCTCGAGCACTTGCGGTAGAAGACACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_004442.6-1927s1c1
Sequence:CCGGGAAGATCTACATCGATCCTTTCTCGAGAAAGGATCGATGTAGATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004442.6-1451s1c1
Sequence:CCGGCCATCGGCAGTGTCCATCATGCTCGAGCATGATGGACACTGCCGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004442.6-3074s1c1
Sequence:CCGGGCGCAGATGAACCAGATTCAGCTCGAGCTGAATCTGGTTCATCTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004442.4-4468s1c1
Sequence:CCGGCCCGGATCATTCACTGTGATACTCGAGTATCACAGTGAATGATCCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004442.4-2658s1c1
Sequence:CCGGGCTAGACAAGATGATCCGCAACTCGAGTTGCGGATCATCTTGTCTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004442.4-207s1c1
Sequence:CCGGCGTGTTTGAGTCAAGCCAGAACTCGAGTTCTGGCTTGACTCAAACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004442.4-1849s1c1
Sequence:CCGGCGGGAGTTTGCCAAGGAAATTCTCGAGAATTTCCTTGGCAAACTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004442.4-1006s1c1
Sequence:CCGGGCTGTGATTTCCAGTGTCAATCTCGAGATTGACACTGGAAATCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004442
VALIDATED
EPHB2 MISSION shRNA shRNA Plasmid DNA
EPH receptor B2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004442.6-2988s21c1
Sequence:CCGGAGATGATGATGGAGGACATTCCTCGAGGAATGTCCTCCATCATCATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004442.6-2452s21c1
Sequence:CCGGACGCTTTCTAGAGGACGATACCTCGAGGTATCGTCCTCTAGAAAGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004442.6-472s21c1
Sequence:CCGGGACCTTCAACCTCTATTACTACTCGAGTAGTAATAGAGGTTGAAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004442.6-3359s21c1
Sequence:CCGGTTTAAAGAGGATTCTCATAAGCTCGAGCTTATGAGAATCCTCTTTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004442.6-3337s21c1
Sequence:CCGGGCGGGAAATACAAGGAATATTCTCGAGAATATTCCTTGTATTTCCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004442.6-851s21c1
Sequence:CCGGCCCATCAAGCTCTACTGTAACCTCGAGGTTACAGTAGAGCTTGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_004442.6-715s1c1
Sequence:CCGGGCGTGTCTTCTACCGCAAGTGCTCGAGCACTTGCGGTAGAAGACACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_004442.6-1927s1c1
Sequence:CCGGGAAGATCTACATCGATCCTTTCTCGAGAAAGGATCGATGTAGATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004442.6-1451s1c1
Sequence:CCGGCCATCGGCAGTGTCCATCATGCTCGAGCATGATGGACACTGCCGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004442.6-3074s1c1
Sequence:CCGGGCGCAGATGAACCAGATTCAGCTCGAGCTGAATCTGGTTCATCTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004442.4-4468s1c1
Sequence:CCGGCCCGGATCATTCACTGTGATACTCGAGTATCACAGTGAATGATCCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004442.4-2658s1c1
Sequence:CCGGGCTAGACAAGATGATCCGCAACTCGAGTTGCGGATCATCTTGTCTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004442.4-207s1c1
Sequence:CCGGCGTGTTTGAGTCAAGCCAGAACTCGAGTTCTGGCTTGACTCAAACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004442.4-1849s1c1
Sequence:CCGGCGGGAGTTTGCCAAGGAAATTCTCGAGAATTTCCTTGGCAAACTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004442.4-1006s1c1
Sequence:CCGGGCTGTGATTTCCAGTGTCAATCTCGAGATTGACACTGGAAATCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004442
VALIDATED
EPHB2 MISSION shRNA Lentiviral Transduction Particles
EPH receptor B2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004442.6-2988s21c1
Sequence:CCGGAGATGATGATGGAGGACATTCCTCGAGGAATGTCCTCCATCATCATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004442.6-2452s21c1
Sequence:CCGGACGCTTTCTAGAGGACGATACCTCGAGGTATCGTCCTCTAGAAAGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004442.6-472s21c1
Sequence:CCGGGACCTTCAACCTCTATTACTACTCGAGTAGTAATAGAGGTTGAAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004442.6-3359s21c1
Sequence:CCGGTTTAAAGAGGATTCTCATAAGCTCGAGCTTATGAGAATCCTCTTTAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004442.6-3337s21c1
Sequence:CCGGGCGGGAAATACAAGGAATATTCTCGAGAATATTCCTTGTATTTCCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004442.6-851s21c1
Sequence:CCGGCCCATCAAGCTCTACTGTAACCTCGAGGTTACAGTAGAGCTTGATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_004442.6-715s1c1
Sequence:CCGGGCGTGTCTTCTACCGCAAGTGCTCGAGCACTTGCGGTAGAAGACACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_004442.6-1927s1c1
Sequence:CCGGGAAGATCTACATCGATCCTTTCTCGAGAAAGGATCGATGTAGATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004442.6-1451s1c1
Sequence:CCGGCCATCGGCAGTGTCCATCATGCTCGAGCATGATGGACACTGCCGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004442.6-3074s1c1
Sequence:CCGGGCGCAGATGAACCAGATTCAGCTCGAGCTGAATCTGGTTCATCTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004442.4-4468s1c1
Sequence:CCGGCCCGGATCATTCACTGTGATACTCGAGTATCACAGTGAATGATCCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004442.4-2658s1c1
Sequence:CCGGGCTAGACAAGATGATCCGCAACTCGAGTTGCGGATCATCTTGTCTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004442.4-207s1c1
Sequence:CCGGCGTGTTTGAGTCAAGCCAGAACTCGAGTTCTGGCTTGACTCAAACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004442.4-1849s1c1
Sequence:CCGGCGGGAGTTTGCCAAGGAAATTCTCGAGAATTTCCTTGGCAAACTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004442.4-1006s1c1
Sequence:CCGGGCTGTGATTTCCAGTGTCAATCTCGAGATTGACACTGGAAATCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010142
EPHB2 MISSION shRNA Bacterial Glycerol Stock
EPH receptor B2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010142.1-3458s1c1
Sequence:CCGGGCCAAGAAACACTTCCAGGAACTCGAGTTCCTGGAAGTGTTTCTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010142.1-252s1c1
Sequence:CCGGCGACGAGAACATGAACACTATCTCGAGATAGTGTTCATGTTCTCGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010142.1-3006s1c1
Sequence:CCGGCCTGAACAGTATCCAGGTGATCTCGAGATCACCTGGATACTGTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010142.1-1876s1c1
Sequence:CCGGCCAGGCATGAAGATCTATATACTCGAGTATATAGATCTTCATGCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010142.1-2931s1c1
Sequence:CCGGCGACGTTGTATCTCAGATGATCTCGAGATCATCTGAGATACAACGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010142.1-3863s1c1
Sequence:CCGGGCCACAGAGAAGCATACTCTTCTCGAGAAGAGTATGCTTCTCTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010142.1-1052s1c1
Sequence:CCGGCCTTAGACATGCCTTGCACAACTCGAGTTGTGCAAGGCATGTCTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010142.1-2602s1c1
Sequence:CCGGCAAGACGTAATCAACGCCATTCTCGAGAATGGCGTTGATTACGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010142.1-2143s1c1
Sequence:CCGGCCCAATGTCATCCATCTGGAACTCGAGTTCCAGATGGATGACATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010142.1-1164s1c1
Sequence:CCGGCGAGGATCTTGTTTACAACATCTCGAGATGTTGTAAACAAGATCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010142
EPHB2 MISSION shRNA shRNA Plasmid DNA
EPH receptor B2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010142.1-3458s1c1
Sequence:CCGGGCCAAGAAACACTTCCAGGAACTCGAGTTCCTGGAAGTGTTTCTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010142.1-252s1c1
Sequence:CCGGCGACGAGAACATGAACACTATCTCGAGATAGTGTTCATGTTCTCGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010142.1-3006s1c1
Sequence:CCGGCCTGAACAGTATCCAGGTGATCTCGAGATCACCTGGATACTGTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010142.1-1876s1c1
Sequence:CCGGCCAGGCATGAAGATCTATATACTCGAGTATATAGATCTTCATGCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010142.1-2931s1c1
Sequence:CCGGCGACGTTGTATCTCAGATGATCTCGAGATCATCTGAGATACAACGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010142.1-3863s1c1
Sequence:CCGGGCCACAGAGAAGCATACTCTTCTCGAGAAGAGTATGCTTCTCTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010142.1-1052s1c1
Sequence:CCGGCCTTAGACATGCCTTGCACAACTCGAGTTGTGCAAGGCATGTCTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010142.1-2602s1c1
Sequence:CCGGCAAGACGTAATCAACGCCATTCTCGAGAATGGCGTTGATTACGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010142.1-2143s1c1
Sequence:CCGGCCCAATGTCATCCATCTGGAACTCGAGTTCCAGATGGATGACATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010142.1-1164s1c1
Sequence:CCGGCGAGGATCTTGTTTACAACATCTCGAGATGTTGTAAACAAGATCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010142
EPHB2 MISSION shRNA Lentiviral Transduction Particles
EPH receptor B2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010142.1-3458s1c1
Sequence:CCGGGCCAAGAAACACTTCCAGGAACTCGAGTTCCTGGAAGTGTTTCTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010142.1-252s1c1
Sequence:CCGGCGACGAGAACATGAACACTATCTCGAGATAGTGTTCATGTTCTCGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010142.1-3006s1c1
Sequence:CCGGCCTGAACAGTATCCAGGTGATCTCGAGATCACCTGGATACTGTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010142.1-1876s1c1
Sequence:CCGGCCAGGCATGAAGATCTATATACTCGAGTATATAGATCTTCATGCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010142.1-2931s1c1
Sequence:CCGGCGACGTTGTATCTCAGATGATCTCGAGATCATCTGAGATACAACGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010142.1-3863s1c1
Sequence:CCGGGCCACAGAGAAGCATACTCTTCTCGAGAAGAGTATGCTTCTCTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010142.1-1052s1c1
Sequence:CCGGCCTTAGACATGCCTTGCACAACTCGAGTTGTGCAAGGCATGTCTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010142.1-2602s1c1
Sequence:CCGGCAAGACGTAATCAACGCCATTCTCGAGAATGGCGTTGATTACGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010142.1-2143s1c1
Sequence:CCGGCCCAATGTCATCCATCTGGAACTCGAGTTCCAGATGGATGACATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010142.1-1164s1c1
Sequence:CCGGCGAGGATCTTGTTTACAACATCTCGAGATGTTGTAAACAAGATCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)