EMAIL THIS PAGE TO A FRIEND

EPS8

epidermal growth factor receptor pathway substrate 8

141 Gene Product Result for
UniProtKB ID: Q12929, A6NMC3, A8K6W2, A8KA66, Q8N6J0
Gene ID:
Human(2059) Summary: This gene encodes a member of the EPS8 family. This protein contains one PH domain and one SH3 domain. It functions as part of the EGFR pathway, though its exact role has not been determined. Highly similar proteins in other organisms are involved in the transduction of signals from Ras to Rac and growth factor-mediated actin remodeling. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
Mouse(13860) epidermal growth factor receptor pathway substrate 8
Rat(312812) epidermal growth factor receptor pathway substrate 8
chicken(418174) epidermal growth factor receptor pathway substrate 8
dog(477686) epidermal growth factor receptor pathway substrate 8
domestic cat(101098550) epidermal growth factor receptor pathway substrate 8
cow(538419) epidermal growth factor receptor pathway substrate 8
Horse(100067366) epidermal growth factor receptor pathway substrate 8
sheep(101104477) epidermal growth factor receptor pathway substrate 8
Domestic Rabbit(100343649) epidermal growth factor receptor pathway substrate 8
domestic guinea pig(100735652) epidermal growth factor receptor pathway substrate 8
naked mole-rat(101715552) epidermal growth factor receptor pathway substrate 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007945 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007945 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007945 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004447 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004447 Rosetta Predictions human pricing
XM_001072957 Rosetta Predictions rat pricing
XM_232499 Rosetta Predictions rat pricing
NM_007945 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202877 predicted 298
2 SASI_Hs01_00202878 predicted 1630
3 SASI_Hs01_00202879 predicted 863
4 SASI_Hs02_00337627 predicted 473
5 SASI_Hs01_00202880 predicted 2405
6 SASI_Hs01_00202882 predicted 2057
7 SASI_Hs01_00202883 predicted 2465
8 SASI_Hs01_00202884 predicted 2486
9 SASI_Hs01_00202885 predicted 761
10 SASI_Hs01_00202886 predicted 1272
11 SASI_Hs01_00202881 predicted 1824
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072957 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341111 predicted 847
2 SASI_Rn02_00341112 predicted 1888
3 SASI_Rn02_00341113 predicted 1486
4 SASI_Rn02_00341114 predicted 2874
5 SASI_Rn02_00341115 predicted 2885
6 SASI_Rn02_00341116 predicted 557
7 SASI_Rn02_00341117 predicted 690
8 SASI_Rn02_00341118 predicted 1402
9 SASI_Rn02_00341119 predicted 1789
10 SASI_Rn02_00341120 predicted 1974
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232499 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387150 predicted 592
2 SASI_Rn02_00387151 predicted 763
3 SASI_Rn02_00387152 predicted 742
4 SASI_Rn02_00387153 predicted 769
5 SASI_Rn02_00387154 predicted 759
6 SASI_Rn02_00387155 predicted 1257
7 SASI_Rn02_00387156 predicted 840
8 SASI_Rn02_00387157 predicted 360
9 SASI_Rn02_00387158 predicted 484
10 SASI_Rn02_00387159 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007945 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312797 predicted 1387
2 SASI_Mm01_00065254 predicted 457
3 SASI_Mm01_00065255 predicted 2628
4 SASI_Mm01_00065256 predicted 1990
5 SASI_Mm01_00065257 predicted 756
6 SASI_Mm02_00312798 predicted 564
7 SASI_Mm01_00065258 predicted 662
8 SASI_Mm01_00065259 predicted 1890
9 SASI_Mm01_00065260 predicted 1768
10 SASI_Mm02_00312799 predicted 2301
11 SASI_Mm01_00065251 predicted 214
12 SASI_Mm01_00065252 predicted 2225
13 SASI_Mm01_00065253 predicted 1309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007945
VALIDATED
EPS8 MISSION shRNA Bacterial Glycerol Stock
epidermal growth factor receptor pathway substrate 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007945.2-2522s21c1
Sequence:CCGGGTAATGGAAGCTCCGAGTTACCTCGAGGTAACTCGGAGCTTCCATTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007945.2-1767s21c1
Sequence:CCGGCGCCAAATCCAAGTACGACTTCTCGAGAAGTCGTACTTGGATTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007945.2-2304s21c1
Sequence:CCGGGAACGTTCCAGTGATCAATATCTCGAGATATTGATCACTGGAACGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007945.2-410s21c1
Sequence:CCGGTCACTGTCGAGGACGGAATAACTCGAGTTATTCCGTCCTCGACAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007945.2-3096s21c1
Sequence:CCGGAGCCTTGTTCGATGATCTAAGCTCGAGCTTAGATCATCGAACAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007945.1-2824s1c1
Sequence:CCGGCGCCATATAAGGAAACAGTATCTCGAGATACTGTTTCCTTATATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007945.1-1775s1c1
Sequence:CCGGGCCTTTCAAGTCAACTCCTAACTCGAGTTAGGAGTTGACTTGAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007945.1-1847s1c1
Sequence:CCGGCGCCAAATCCAAGTACGACTTCTCGAGAAGTCGTACTTGGATTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007945.1-2586s1c1
Sequence:CCGGGCTGCTTTGGAGGACAGTAATCTCGAGATTACTGTCCTCCAAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007945.1-503s1c1
Sequence:CCGGCGGAATAAGAAAGCTGAAGTTCTCGAGAACTTCAGCTTTCTTATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007945
VALIDATED
EPS8 MISSION shRNA shRNA Plasmid DNA
epidermal growth factor receptor pathway substrate 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007945.2-2522s21c1
Sequence:CCGGGTAATGGAAGCTCCGAGTTACCTCGAGGTAACTCGGAGCTTCCATTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007945.2-1767s21c1
Sequence:CCGGCGCCAAATCCAAGTACGACTTCTCGAGAAGTCGTACTTGGATTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007945.2-2304s21c1
Sequence:CCGGGAACGTTCCAGTGATCAATATCTCGAGATATTGATCACTGGAACGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007945.2-410s21c1
Sequence:CCGGTCACTGTCGAGGACGGAATAACTCGAGTTATTCCGTCCTCGACAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007945.2-3096s21c1
Sequence:CCGGAGCCTTGTTCGATGATCTAAGCTCGAGCTTAGATCATCGAACAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007945.1-2824s1c1
Sequence:CCGGCGCCATATAAGGAAACAGTATCTCGAGATACTGTTTCCTTATATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007945.1-1775s1c1
Sequence:CCGGGCCTTTCAAGTCAACTCCTAACTCGAGTTAGGAGTTGACTTGAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007945.1-1847s1c1
Sequence:CCGGCGCCAAATCCAAGTACGACTTCTCGAGAAGTCGTACTTGGATTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007945.1-2586s1c1
Sequence:CCGGGCTGCTTTGGAGGACAGTAATCTCGAGATTACTGTCCTCCAAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007945.1-503s1c1
Sequence:CCGGCGGAATAAGAAAGCTGAAGTTCTCGAGAACTTCAGCTTTCTTATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007945
VALIDATED
EPS8 MISSION shRNA Lentiviral Transduction Particles
epidermal growth factor receptor pathway substrate 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007945.2-2522s21c1
Sequence:CCGGGTAATGGAAGCTCCGAGTTACCTCGAGGTAACTCGGAGCTTCCATTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007945.2-1767s21c1
Sequence:CCGGCGCCAAATCCAAGTACGACTTCTCGAGAAGTCGTACTTGGATTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007945.2-2304s21c1
Sequence:CCGGGAACGTTCCAGTGATCAATATCTCGAGATATTGATCACTGGAACGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007945.2-410s21c1
Sequence:CCGGTCACTGTCGAGGACGGAATAACTCGAGTTATTCCGTCCTCGACAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007945.2-3096s21c1
Sequence:CCGGAGCCTTGTTCGATGATCTAAGCTCGAGCTTAGATCATCGAACAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007945.1-2824s1c1
Sequence:CCGGCGCCATATAAGGAAACAGTATCTCGAGATACTGTTTCCTTATATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007945.1-1775s1c1
Sequence:CCGGGCCTTTCAAGTCAACTCCTAACTCGAGTTAGGAGTTGACTTGAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007945.1-1847s1c1
Sequence:CCGGCGCCAAATCCAAGTACGACTTCTCGAGAAGTCGTACTTGGATTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007945.1-2586s1c1
Sequence:CCGGGCTGCTTTGGAGGACAGTAATCTCGAGATTACTGTCCTCCAAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007945.1-503s1c1
Sequence:CCGGCGGAATAAGAAAGCTGAAGTTCTCGAGAACTTCAGCTTTCTTATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004447
VALIDATED
EPS8 MISSION shRNA Bacterial Glycerol Stock
epidermal growth factor receptor pathway substrate 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004447.5-1980s21c1
Sequence:CCGGCCAACTTCTAATCGCCATATACTCGAGTATATGGCGATTAGAAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004447.5-1588s21c1
Sequence:CCGGCCCTATTGAATAAGGACACAACTCGAGTTGTGTCCTTATTCAATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004447.5-1464s21c1
Sequence:CCGGGCCAAACTGAAGTCTCATATTCTCGAGAATATGAGACTTCAGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_004447.5-2859s21c1
Sequence:CCGGGCTAGTGATTCAGGAGTGGAACTCGAGTTCCACTCCTGAATCACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004447.3-1400s1c1
Sequence:CCGGCCCTATTGAATAAGGACACAACTCGAGTTGTGTCCTTATTCAATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004447.3-1792s1c1
Sequence:CCGGCCAACTTCTAATCGCCATATACTCGAGTATATGGCGATTAGAAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004447.3-2671s1c1
Sequence:CCGGGCTAGTGATTCAGGAGTGGAACTCGAGTTCCACTCCTGAATCACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004447.3-2200s1c1
Sequence:CCGGCCAGCAAATATAACACGTCAACTCGAGTTGACGTGTTATATTTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004447.3-1276s1c1
Sequence:CCGGGCCAAACTGAAGTCTCATATTCTCGAGAATATGAGACTTCAGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004447
VALIDATED
EPS8 MISSION shRNA shRNA Plasmid DNA
epidermal growth factor receptor pathway substrate 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004447.5-1980s21c1
Sequence:CCGGCCAACTTCTAATCGCCATATACTCGAGTATATGGCGATTAGAAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004447.5-1588s21c1
Sequence:CCGGCCCTATTGAATAAGGACACAACTCGAGTTGTGTCCTTATTCAATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004447.5-1464s21c1
Sequence:CCGGGCCAAACTGAAGTCTCATATTCTCGAGAATATGAGACTTCAGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_004447.5-2859s21c1
Sequence:CCGGGCTAGTGATTCAGGAGTGGAACTCGAGTTCCACTCCTGAATCACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004447.3-1400s1c1
Sequence:CCGGCCCTATTGAATAAGGACACAACTCGAGTTGTGTCCTTATTCAATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004447.3-1792s1c1
Sequence:CCGGCCAACTTCTAATCGCCATATACTCGAGTATATGGCGATTAGAAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004447.3-2671s1c1
Sequence:CCGGGCTAGTGATTCAGGAGTGGAACTCGAGTTCCACTCCTGAATCACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004447.3-2200s1c1
Sequence:CCGGCCAGCAAATATAACACGTCAACTCGAGTTGACGTGTTATATTTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004447.3-1276s1c1
Sequence:CCGGGCCAAACTGAAGTCTCATATTCTCGAGAATATGAGACTTCAGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004447
VALIDATED
EPS8 MISSION shRNA Lentiviral Transduction Particles
epidermal growth factor receptor pathway substrate 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004447.5-1980s21c1
Sequence:CCGGCCAACTTCTAATCGCCATATACTCGAGTATATGGCGATTAGAAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004447.5-1588s21c1
Sequence:CCGGCCCTATTGAATAAGGACACAACTCGAGTTGTGTCCTTATTCAATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004447.5-1464s21c1
Sequence:CCGGGCCAAACTGAAGTCTCATATTCTCGAGAATATGAGACTTCAGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_004447.5-2859s21c1
Sequence:CCGGGCTAGTGATTCAGGAGTGGAACTCGAGTTCCACTCCTGAATCACTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004447.3-1400s1c1
Sequence:CCGGCCCTATTGAATAAGGACACAACTCGAGTTGTGTCCTTATTCAATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004447.3-1792s1c1
Sequence:CCGGCCAACTTCTAATCGCCATATACTCGAGTATATGGCGATTAGAAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004447.3-2671s1c1
Sequence:CCGGGCTAGTGATTCAGGAGTGGAACTCGAGTTCCACTCCTGAATCACTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004447.3-2200s1c1
Sequence:CCGGCCAGCAAATATAACACGTCAACTCGAGTTGACGTGTTATATTTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004447.3-1276s1c1
Sequence:CCGGGCCAAACTGAAGTCTCATATTCTCGAGAATATGAGACTTCAGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)