EMAIL THIS PAGE TO A FRIEND

ERBB2

v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2

149 Gene Product Result for
Synonyms: CD340 HER-2 HER-2/neu HER2 MLN 19 NEU NGL TKR1
UniProtKB ID: P04626, B2RZG3, B4DHN3, Q14256, Q6LDV1, Q9UMK4
Gene ID:
Human(2064) Summary: This gene encodes a member of the epidermal growth factor (EGF) receptor family of receptor tyrosine kinases. This protein has no ligand binding domain of its own and therefore cannot bind growth factors. However, it does bind tightly to other ligand-bound EGF receptor family members to form a heterodimer, stabilizing ligand binding and enhancing kinase-mediated activation of downstream signalling pathways, such as those involving mitogen-activated protein kinase and phosphatidylinositol-3 kinase. Allelic variations at amino acid positions 654 and 655 of isoform a (positions 624 and 625 of isoform b) have been reported, with the most common allele, Ile654/Ile655, shown here. Amplification and/or overexpression of this gene has been reported in numerous cancers, including breast and ovarian tumors. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized. [provided by RefSeq, Jul 2008]
Mouse(13866) v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)
Rat(24337) v-erb-b2 avian erythroblastic leukemia viral oncogene 2
sheep(780519) v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)
Domestic Rabbit(100009554) v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)
naked mole-rat(101705227) v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)
domestic guinea pig(100727657) v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)
Zebrafish(386966) v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog
cow(505709) v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2
Horse(100054739) v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)
domestic cat(751824) v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)
dog(403883) v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)
chicken(426130) v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500079 Anti-C-ERBB-2/HER-2 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP101, affinity isolated antibody human (tested)
immunohistochemistry pricing
SAB5500080 Anti-C-ERBB-2/HER-2 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP3, tissue culture supernatant human (tested)
immunohistochemistry pricing
SAB3500215 Anti-erbB-2 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB4300350 Anti-ERBB2 (Ab-1221/1222) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300351 Anti-ERBB2 (Ab-1248) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300349 Anti-ERBB2 (Ab-877) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
GW22631 Anti-ERBB2 antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, rat, human
immunocytochemistry, western blot pricing
HPA001383 Anti-ERBB2 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA001060 Anti-ERBB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
HPA001338 Anti-ERBB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4500782 Anti-HER2 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence pricing
SAB4500783 Anti-HER2 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4500784 Anti-HER2 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence pricing
SAB4500785 Anti-HER2 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4500786 Anti-HER2 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4500787 Anti-HER2 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4500788 Anti-HER2 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4500789 Anti-HER2 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1302595 ANTI-MOUSE ERBB2 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4300058 Anti-phospho-ERBB2 (pTyr1221/pTyr1222) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, western blot pricing
SAB4300061 Anti-phospho-ERBB2 (pTyr1248) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300057 Anti-phospho-ERBB2 (pTyr877) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB4504191 Anti-phospho-HER2 (pThr686) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry pricing
SAB4504586 Anti-phospho-HER2 (pTyr1112) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4301403 Anti-phospho-HER2 (pTyr1112) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504192 Anti-phospho-HER2 (pTyr1139) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry pricing
SAB4504425 Anti-phospho-HER2 (pTyr1221/Tyr1222) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504427 Anti-phospho-HER2 (pTyr877) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB1305460 ANTI-PHOSPHO-HER2(Y1112) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
E2777 Monoclonal Anti-c-erbB-2 antibody produced in mouse ~2 mg/mL, clone HER2-96, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), microarray pricing
WH0002064M6 Monoclonal Anti-ERBB2 antibody produced in mouse clone 4B8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403787 Monoclonal Anti-ERBB2 antibody produced in mouse clone 3B1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, proximity ligation assay, western blot pricing
SAB4100372 Monoclonal Anti-ERBB2 antibody produced in mouse clone ERBB2-A316, culture supernatant human
western blot pricing
AMAB90628 Monoclonal Anti-HER2 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0269, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90627 Monoclonal Anti-HER2 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0268, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
PLA0123 Rabbit anti-ErbB2 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human
immunohistochemistry, immunoprecipitation (IP), proximity ligation assay, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0896 AQUA Peptide GLQSLPTHDPSPLQ[R] human pricing
AQ0730 AQUA Peptide PTQCVNCSQFL[R] human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004448 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004448 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004448 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_109715 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_109715 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_109715 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001003817 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003817 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003817 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
MABE320 Anti-c-ErbB2/c-Neu (Ab-5) Antibody, clone TA-1 This Anti-c-ErbB2/c-Neu (Ab-5) Antibody, clone TA-1 is validated for use in Western Blotting, Flow Cytometry, Immunoprecipitation, Immunofluorescence for the detection of c-ErbB2/c-Neu (Ab-5). pricing
MABE330 Anti-c-ErbB2/c-Neu Antibody, clone 3B5 Anti-c-ErbB2/c-Neu Antibody, clone 3B5 is a Mouse Monoclonal Antibody for detection of c-ErbB2/c-Neu also known as MLN 19, Proto-oncogene Neu, Proto-oncogene c-ErbB-2 or CD340, has been validated in WB & IHC. pricing
MABE332 Anti-c-ErbB2/c-Neu Antibody, clone 9G6 Use Anti-c-ErbB2/c-Neu Antibody, clone 9G6 (Mouse Monoclonal Antibody) validated in IP & IHC to detect c-ErbB2/c-Neu also known as MLN 19, Proto-oncogene Neu or Proto-oncogene c-ErbB-2. pricing
04-291 Anti-erbB2 (intracellular domain) Antibody, clone 24B5 Anti-erbB2 (intracellular domain) Antibody, clone 24B5 detects level of erbB2 (intracellular domain) & has been published & validated for use in ELISA & WB. pricing
04-294 Anti-phosho-erbB2/Her2 (Tyr1112) Antibody, clone 19G5 Detect phosho-erbB2/Her2 (Tyr1112) using this Anti-phosho-erbB2/Her2 (Tyr1112) Antibody, clone 19G5 validated for use in ELISA & WB. pricing
06-229 Anti-phospho-erbB-2/HER-2 (Tyr1248) Antibody This Anti-phospho-erbB-2/HER-2 (Tyr1248) Antibody is validated for use in IC, WB for the detection of phospho-erbB-2/HER-2 (Tyr1248). pricing
16-235 Anti-phospho-erbB-2/HER-2 (Tyr1248) Antibody, Alexa Fluor® 488 This Anti-phospho-erbB-2/HER-2 (Tyr1248) Antibody, Alexa Fluor 488 is validated for use in FC, IC for the detection of phospho-erbB-2/HER-2 (Tyr1248). pricing
16-236 Anti-phospho-erbB-2/HER-2 (Tyr1248) Antibody, Alexa Fluor® 555 Anti-phospho-erbB-2/HER-2 (Tyr1248) Antibody, Alexa Fluor 555 is an antibody against phospho-erbB-2/HER-2 (Tyr1248) for use in FC & IC. pricing
04-293 Anti-phospho-erbB2 (Thr686) Antibody, clone 7F8 Anti-phospho-erbB2 (Thr686) Antibody, clone 7F8 is an antibody against phospho-erbB2 (Thr686) for use in ELISA & WB. pricing
14-939-M ErbB2, active pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005862 Rosetta Predictions human pricing
NM_004448 Rosetta Predictions human pricing
NM_017003 Rosetta Predictions rat pricing
NM_001003817 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010288 predicted 1490
2 SASI_Hs02_00305041 predicted 2132
3 SASI_Hs01_00010289 predicted 2677
4 SASI_Hs01_00010290 predicted 2841
5 SASI_Hs01_00010291 predicted 2460
6 SASI_Hs01_00010292 predicted 3132
7 SASI_Hs01_00010293 predicted 2817
8 SASI_Hs01_00010294 predicted 3144
9 SASI_Hs01_00010295 predicted 1332
10 SASI_Hs02_00305042 predicted 2012
11 SASI_Hs01_00010287 predicted 2255
12 SASI_Hs01_00010296 predicted 2719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077799 predicted 1299
2 SASI_Hs02_00337628 predicted 1944
3 SASI_Hs01_00077800 predicted 2485
4 SASI_Hs01_00077801 predicted 2646
5 SASI_Hs01_00077802 predicted 2268
6 SASI_Hs01_00077803 predicted 2940
7 SASI_Hs01_00077804 predicted 2630
8 SASI_Hs01_00077805 predicted 2946
9 SASI_Hs01_00077806 predicted 1147
10 SASI_Hs02_00337629 predicted 1819
11 SASI_Hs01_00077798 predicted 2061
12 SASI_Hs01_00077807 predicted 2529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017003 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102444 predicted 2766
2 SASI_Rn01_00102445 predicted 947
3 SASI_Rn01_00102446 predicted 2067
4 SASI_Rn01_00102447 predicted 2149
5 SASI_Rn01_00102448 predicted 2400
6 SASI_Rn01_00102449 predicted 1690
7 SASI_Rn01_00102450 predicted 2189
8 SASI_Rn01_00102451 predicted 2420
9 SASI_Rn01_00102452 predicted 3855
10 SASI_Rn02_00261153 predicted 1021
11 SASI_Rn01_00102443 predicted 2490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003817 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078044 predicted 351
2 SASI_Mm02_00286337 predicted 2826
3 SASI_Mm01_00078045 predicted 3073
4 SASI_Mm01_00078046 predicted 2131
5 SASI_Mm01_00078047 predicted 2210
6 SASI_Mm01_00078048 predicted 1247
7 SASI_Mm01_00078049 predicted 601
8 SASI_Mm01_00078050 predicted 242
9 SASI_Mm01_00078052 predicted 3959
10 SASI_Mm01_00078053 predicted 2170
11 SASI_Mm01_00078051 predicted 3992
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004448
VALIDATED
ERBB2 MISSION shRNA Bacterial Glycerol Stock
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004448.x-1214s1c1
Sequence:CCGGCAGTTACCAGTGCCAATATCCCTCGAGGGATATTGGCACTGGTAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004448.2-1453s21c1
Sequence:CCGGGATCACAGGTTACCTATACATCTCGAGATGTATAGGTAACCTGTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A-431
TRC Version: 1 Clone ID:NM_004448.x-1365s1c1
Sequence:CCGGATCACAGGTTACCTATACATCTCGAGATGTATAGGTAACCTGTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004448.1-4355s1c1
Sequence:CCGGTGTCAGTATCCAGGCTTTGTACTCGAGTACAAAGCCTGGATACTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_004448.2-4352s1c1
Sequence:CCGGCCCTAAGGGAGTGTCTAAGAACTCGAGTTCTTAGACACTCCCTTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004448.2-1990s1c1
Sequence:CCGGTGTGGCCTGTGCCCACTATAACTCGAGTTATAGTGGGCACAGGCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004448.1-1221s1c1
Sequence:CCGGCAGTGCCAATATCCAGGAGTTCTCGAGAACTCCTGGATATTGGCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004448.1-3562s1c1
Sequence:CCGGGAATATGTGAACCAGCCAGATCTCGAGATCTGGCTGGTTCACATATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004448.2-3884s21c1
Sequence:GTACCGGGCCTTCGACAACCTCTATTACCTCGAGGTAATAGAGGTTGTCGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004448.2-720s21c1
Sequence:GTACCGGTCTGCTACCAGGACACGATTTCTCGAGAAATCGTGTCCTGGTAGCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004448.2-1309s21c1
Sequence:CCGGCAGTGCCAATATCCAGGAGTTCTCGAGAACTCCTGGATATTGGCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004448.2-1451s1c1
Sequence:CCGGGAGATCACAGGTTACCTATACCTCGAGGTATAGGTAACCTGTGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004448.2-4125s1c1
Sequence:CCGGGCCAGGAACCTGTCCTAAGGACTCGAGTCCTTAGGACAGGTTCCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004448.2-3883s1c1
Sequence:CCGGAGCCTTCGACAACCTCTATTACTCGAGTAATAGAGGTTGTCGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_004448.2-3650s21c1
Sequence:CCGGGAATATGTGAACCAGCCAGATCTCGAGATCTGGCTGGTTCACATATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004448.2-4443s21c1
Sequence:CCGGTGTCAGTATCCAGGCTTTGTACTCGAGTACAAAGCCTGGATACTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004448
VALIDATED
ERBB2 MISSION shRNA shRNA Plasmid DNA
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004448.x-1214s1c1
Sequence:CCGGCAGTTACCAGTGCCAATATCCCTCGAGGGATATTGGCACTGGTAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004448.2-1453s21c1
Sequence:CCGGGATCACAGGTTACCTATACATCTCGAGATGTATAGGTAACCTGTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A-431
TRC Version: 1 Clone ID:NM_004448.x-1365s1c1
Sequence:CCGGATCACAGGTTACCTATACATCTCGAGATGTATAGGTAACCTGTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004448.1-4355s1c1
Sequence:CCGGTGTCAGTATCCAGGCTTTGTACTCGAGTACAAAGCCTGGATACTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_004448.2-4352s1c1
Sequence:CCGGCCCTAAGGGAGTGTCTAAGAACTCGAGTTCTTAGACACTCCCTTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004448.2-1990s1c1
Sequence:CCGGTGTGGCCTGTGCCCACTATAACTCGAGTTATAGTGGGCACAGGCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004448.1-1221s1c1
Sequence:CCGGCAGTGCCAATATCCAGGAGTTCTCGAGAACTCCTGGATATTGGCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004448.1-3562s1c1
Sequence:CCGGGAATATGTGAACCAGCCAGATCTCGAGATCTGGCTGGTTCACATATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004448.2-3884s21c1
Sequence:GTACCGGGCCTTCGACAACCTCTATTACCTCGAGGTAATAGAGGTTGTCGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004448.2-720s21c1
Sequence:GTACCGGTCTGCTACCAGGACACGATTTCTCGAGAAATCGTGTCCTGGTAGCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004448.2-1309s21c1
Sequence:CCGGCAGTGCCAATATCCAGGAGTTCTCGAGAACTCCTGGATATTGGCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004448.2-1451s1c1
Sequence:CCGGGAGATCACAGGTTACCTATACCTCGAGGTATAGGTAACCTGTGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004448.2-4125s1c1
Sequence:CCGGGCCAGGAACCTGTCCTAAGGACTCGAGTCCTTAGGACAGGTTCCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004448.2-3883s1c1
Sequence:CCGGAGCCTTCGACAACCTCTATTACTCGAGTAATAGAGGTTGTCGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_004448.2-3650s21c1
Sequence:CCGGGAATATGTGAACCAGCCAGATCTCGAGATCTGGCTGGTTCACATATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004448.2-4443s21c1
Sequence:CCGGTGTCAGTATCCAGGCTTTGTACTCGAGTACAAAGCCTGGATACTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004448
VALIDATED
ERBB2 MISSION shRNA Lentiviral Transduction Particles
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004448.x-1214s1c1
Sequence:CCGGCAGTTACCAGTGCCAATATCCCTCGAGGGATATTGGCACTGGTAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004448.2-1453s21c1
Sequence:CCGGGATCACAGGTTACCTATACATCTCGAGATGTATAGGTAACCTGTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A-431
TRC Version: 1 Clone ID:NM_004448.x-1365s1c1
Sequence:CCGGATCACAGGTTACCTATACATCTCGAGATGTATAGGTAACCTGTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004448.1-4355s1c1
Sequence:CCGGTGTCAGTATCCAGGCTTTGTACTCGAGTACAAAGCCTGGATACTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_004448.2-4352s1c1
Sequence:CCGGCCCTAAGGGAGTGTCTAAGAACTCGAGTTCTTAGACACTCCCTTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004448.2-1990s1c1
Sequence:CCGGTGTGGCCTGTGCCCACTATAACTCGAGTTATAGTGGGCACAGGCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004448.1-1221s1c1
Sequence:CCGGCAGTGCCAATATCCAGGAGTTCTCGAGAACTCCTGGATATTGGCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004448.1-3562s1c1
Sequence:CCGGGAATATGTGAACCAGCCAGATCTCGAGATCTGGCTGGTTCACATATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004448.2-3884s21c1
Sequence:GTACCGGGCCTTCGACAACCTCTATTACCTCGAGGTAATAGAGGTTGTCGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004448.2-720s21c1
Sequence:GTACCGGTCTGCTACCAGGACACGATTTCTCGAGAAATCGTGTCCTGGTAGCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004448.2-1309s21c1
Sequence:CCGGCAGTGCCAATATCCAGGAGTTCTCGAGAACTCCTGGATATTGGCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004448.2-1451s1c1
Sequence:CCGGGAGATCACAGGTTACCTATACCTCGAGGTATAGGTAACCTGTGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004448.2-4125s1c1
Sequence:CCGGGCCAGGAACCTGTCCTAAGGACTCGAGTCCTTAGGACAGGTTCCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004448.2-3883s1c1
Sequence:CCGGAGCCTTCGACAACCTCTATTACTCGAGTAATAGAGGTTGTCGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_004448.2-3650s21c1
Sequence:CCGGGAATATGTGAACCAGCCAGATCTCGAGATCTGGCTGGTTCACATATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004448.2-4443s21c1
Sequence:CCGGTGTCAGTATCCAGGCTTTGTACTCGAGTACAAAGCCTGGATACTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_109715
ERBB2 MISSION shRNA Bacterial Glycerol Stock
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000023386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109715.3-2153s1c1
Sequence:CCGGCGTCCTGTTGTTCCTGATCATCTCGAGATGATCAGGAACAACAGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109715.3-1936s1c1
Sequence:CCGGCCCACTACAAGGACTCATCTTCTCGAGAAGATGAGTCCTTGTAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109715.3-689s1c1
Sequence:CCGGCCTCCGTAAGAATAACCAGCTCTCGAGAGCTGGTTATTCTTACGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109715.3-1266s1c1
Sequence:CCGGGCTGGCTGCAAGAAGATCTTTCTCGAGAAAGATCTTCTTGCAGCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_109715
ERBB2 MISSION shRNA shRNA Plasmid DNA
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000023386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109715.3-2153s1c1
Sequence:CCGGCGTCCTGTTGTTCCTGATCATCTCGAGATGATCAGGAACAACAGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109715.3-1936s1c1
Sequence:CCGGCCCACTACAAGGACTCATCTTCTCGAGAAGATGAGTCCTTGTAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109715.3-689s1c1
Sequence:CCGGCCTCCGTAAGAATAACCAGCTCTCGAGAGCTGGTTATTCTTACGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109715.3-1266s1c1
Sequence:CCGGGCTGGCTGCAAGAAGATCTTTCTCGAGAAAGATCTTCTTGCAGCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_109715
ERBB2 MISSION shRNA Lentiviral Transduction Particles
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000023386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109715.3-2153s1c1
Sequence:CCGGCGTCCTGTTGTTCCTGATCATCTCGAGATGATCAGGAACAACAGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109715.3-1936s1c1
Sequence:CCGGCCCACTACAAGGACTCATCTTCTCGAGAAGATGAGTCCTTGTAGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109715.3-689s1c1
Sequence:CCGGCCTCCGTAAGAATAACCAGCTCTCGAGAGCTGGTTATTCTTACGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109715.3-1266s1c1
Sequence:CCGGGCTGGCTGCAAGAAGATCTTTCTCGAGAAAGATCTTCTTGCAGCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003817
VALIDATED
ERBB2 MISSION shRNA Bacterial Glycerol Stock
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003817.1-4457s21c1
Sequence:CCGGGTGGGAGAGTGGGTGTTATATCTCGAGATATAACACCCACTCTCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003817.1-3827s21c1
Sequence:GTACCGGAGCCTTTGACAACCTCTATTACTCGAGTAATAGAGGTTGTCAAAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003817.1-2176s21c1
Sequence:CCGGTGATCATAGTGGTGGTCATTGCTCGAGCAATGACCACCACTATGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003817.1-2218s21c1
Sequence:CCGGGACAGAAGATCCGGAAGTATACTCGAGTATACTTCCGGATCTTCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003817.1-1394s21c1
Sequence:CCGGGGAGATCACAGGTTACCTATACTCGAGTATAGGTAACCTGTGATCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003817
VALIDATED
ERBB2 MISSION shRNA shRNA Plasmid DNA
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003817.1-4457s21c1
Sequence:CCGGGTGGGAGAGTGGGTGTTATATCTCGAGATATAACACCCACTCTCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003817.1-3827s21c1
Sequence:GTACCGGAGCCTTTGACAACCTCTATTACTCGAGTAATAGAGGTTGTCAAAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003817.1-2176s21c1
Sequence:CCGGTGATCATAGTGGTGGTCATTGCTCGAGCAATGACCACCACTATGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003817.1-2218s21c1
Sequence:CCGGGACAGAAGATCCGGAAGTATACTCGAGTATACTTCCGGATCTTCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003817.1-1394s21c1
Sequence:CCGGGGAGATCACAGGTTACCTATACTCGAGTATAGGTAACCTGTGATCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003817
VALIDATED
ERBB2 MISSION shRNA Lentiviral Transduction Particles
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003817.1-4457s21c1
Sequence:CCGGGTGGGAGAGTGGGTGTTATATCTCGAGATATAACACCCACTCTCCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003817.1-3827s21c1
Sequence:GTACCGGAGCCTTTGACAACCTCTATTACTCGAGTAATAGAGGTTGTCAAAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003817.1-2176s21c1
Sequence:CCGGTGATCATAGTGGTGGTCATTGCTCGAGCAATGACCACCACTATGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003817.1-2218s21c1
Sequence:CCGGGACAGAAGATCCGGAAGTATACTCGAGTATACTTCCGGATCTTCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003817.1-1394s21c1
Sequence:CCGGGGAGATCACAGGTTACCTATACTCGAGTATAGGTAACCTGTGATCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)