EMAIL THIS PAGE TO A FRIEND

ERCC2

excision repair cross-complementing rodent repair deficiency, complementation group 2

53 Gene Product Result for
Synonyms: COFS2 EM9 TTD XPD
UniProtKB ID: P18074, Q2TB78, Q2YDY2, Q7KZU6, Q8N721
Gene ID:
Human(2068) Summary: The nucleotide excision repair pathway is a mechanism to repair damage to DNA. The protein encoded by this gene is involved in transcription-coupled nucleotide excision repair and is an integral member of the basal transcription factor BTF2/TFIIH complex. The gene product has ATP-dependent DNA helicase activity and belongs to the RAD3/XPD subfamily of helicases. Defects in this gene can result in three different disorders, the cancer-prone syndrome xeroderma pigmentosum complementation group D, trichothiodystrophy, and Cockayne syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Mouse(13871) excision repair cross-complementing rodent repair deficiency, complementation group 2
Rat(308415) excision repair cross-complementing rodent repair deficiency, complementation group 2
domestic guinea pig(100721308) excision repair cross-complementing rodent repair deficiency, complementation group 2
naked mole-rat(101697378) excision repair cross-complementing rodent repair deficiency, complementation group 2
sheep(101116341) excision repair cross-complementing rodent repair deficiency, complementation group 2
Domestic Rabbit(100347957) excision repair cross-complementing rodent repair deficiency, complementation group 2
Zebrafish(393900) excision repair cross-complementing rodent repair deficiency, complementation group 2
cow(100125238) excision repair cross-complementing rodent repair deficiency, complementation group 2
domestic cat(101095702) excision repair cross-complementing rodent repair deficiency, complementation group 2
dog(493995) excision repair cross-complementing rodent repair deficiency, complementation group 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007949 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007949 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007949 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000400 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000400 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000400 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000400 Rosetta Predictions human pricing
NM_007949 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000400 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232954 predicted 291
2 SASI_Hs01_00232955 predicted 596
3 SASI_Hs01_00232956 predicted 260
4 SASI_Hs01_00232957 predicted 1366
5 SASI_Hs02_00302476 predicted 1355
6 SASI_Hs01_00232958 predicted 1844
7 SASI_Hs01_00232960 predicted 233
8 SASI_Hs01_00232961 predicted 1238
9 SASI_Hs01_00232962 predicted 212
10 SASI_Hs01_00232963 predicted 1958
11 SASI_Hs01_00232959 predicted 1962
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007949 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156356 predicted 693
2 SASI_Mm02_00312816 predicted 1346
3 SASI_Mm01_00156357 predicted 1814
4 SASI_Mm01_00156358 predicted 2267
5 SASI_Mm01_00156359 predicted 740
6 SASI_Mm01_00156360 predicted 1870
7 SASI_Mm01_00156361 predicted 427
8 SASI_Mm01_00156362 predicted 240
9 SASI_Mm01_00156364 predicted 1254
10 SASI_Mm01_00156365 predicted 344
11 SASI_Mm01_00156363 predicted 2261
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007949
VALIDATED
ERCC2 MISSION shRNA Bacterial Glycerol Stock
excision repair cross-complementing rodent repair deficiency, complementation group 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007949.4-1493s21c1
Sequence:CCGGATGATCATTGGCCGTGGTAATCTCGAGATTACCACGGCCAATGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007949.4-1767s21c1
Sequence:CCGGACCAAGAGGCATGCGAGAATGCTCGAGCATTCTCGCATGCCTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007949.4-1520s21c1
Sequence:CCGGGTAGCAATCAGCTCCAAATTTCTCGAGAAATTTGGAGCTGATTGCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007949.4-2579s21c1
Sequence:CCGGGAGAGCACAGGAATGGTTAGACTCGAGTCTAACCATTCCTGTGCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007949.4-1247s21c1
Sequence:CCGGGCCAAGGGCTTCACCATTATCCTCGAGGATAATGGTGAAGCCCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007949.2-1700s1c1
Sequence:CCGGCCAGAGGAACAAACTGCTCTTCTCGAGAAGAGCAGTTTGTTCCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007949.2-702s1c1
Sequence:CCGGGCTGTTGTGGTCTTCGATGAACTCGAGTTCATCGAAGACCACAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007949.2-275s1c1
Sequence:CCGGGCTTCGTAAGCTACTCAGCTTCTCGAGAAGCTGAGTAGCTTACGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007949.2-1959s1c1
Sequence:CCGGGAGAACGACTTCCTCACCTTTCTCGAGAAAGGTGAGGAAGTCGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007949.2-1518s1c1
Sequence:CCGGCAGGTAGCAATCAGCTCCAAACTCGAGTTTGGAGCTGATTGCTACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007949
VALIDATED
ERCC2 MISSION shRNA shRNA Plasmid DNA
excision repair cross-complementing rodent repair deficiency, complementation group 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007949.4-1493s21c1
Sequence:CCGGATGATCATTGGCCGTGGTAATCTCGAGATTACCACGGCCAATGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007949.4-1767s21c1
Sequence:CCGGACCAAGAGGCATGCGAGAATGCTCGAGCATTCTCGCATGCCTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007949.4-1520s21c1
Sequence:CCGGGTAGCAATCAGCTCCAAATTTCTCGAGAAATTTGGAGCTGATTGCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007949.4-2579s21c1
Sequence:CCGGGAGAGCACAGGAATGGTTAGACTCGAGTCTAACCATTCCTGTGCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007949.4-1247s21c1
Sequence:CCGGGCCAAGGGCTTCACCATTATCCTCGAGGATAATGGTGAAGCCCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007949.2-1700s1c1
Sequence:CCGGCCAGAGGAACAAACTGCTCTTCTCGAGAAGAGCAGTTTGTTCCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007949.2-702s1c1
Sequence:CCGGGCTGTTGTGGTCTTCGATGAACTCGAGTTCATCGAAGACCACAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007949.2-275s1c1
Sequence:CCGGGCTTCGTAAGCTACTCAGCTTCTCGAGAAGCTGAGTAGCTTACGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007949.2-1959s1c1
Sequence:CCGGGAGAACGACTTCCTCACCTTTCTCGAGAAAGGTGAGGAAGTCGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007949.2-1518s1c1
Sequence:CCGGCAGGTAGCAATCAGCTCCAAACTCGAGTTTGGAGCTGATTGCTACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007949
VALIDATED
ERCC2 MISSION shRNA Lentiviral Transduction Particles
excision repair cross-complementing rodent repair deficiency, complementation group 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007949.4-1493s21c1
Sequence:CCGGATGATCATTGGCCGTGGTAATCTCGAGATTACCACGGCCAATGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007949.4-1767s21c1
Sequence:CCGGACCAAGAGGCATGCGAGAATGCTCGAGCATTCTCGCATGCCTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007949.4-1520s21c1
Sequence:CCGGGTAGCAATCAGCTCCAAATTTCTCGAGAAATTTGGAGCTGATTGCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007949.4-2579s21c1
Sequence:CCGGGAGAGCACAGGAATGGTTAGACTCGAGTCTAACCATTCCTGTGCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007949.4-1247s21c1
Sequence:CCGGGCCAAGGGCTTCACCATTATCCTCGAGGATAATGGTGAAGCCCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007949.2-1700s1c1
Sequence:CCGGCCAGAGGAACAAACTGCTCTTCTCGAGAAGAGCAGTTTGTTCCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007949.2-702s1c1
Sequence:CCGGGCTGTTGTGGTCTTCGATGAACTCGAGTTCATCGAAGACCACAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007949.2-275s1c1
Sequence:CCGGGCTTCGTAAGCTACTCAGCTTCTCGAGAAGCTGAGTAGCTTACGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007949.2-1959s1c1
Sequence:CCGGGAGAACGACTTCCTCACCTTTCTCGAGAAAGGTGAGGAAGTCGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007949.2-1518s1c1
Sequence:CCGGCAGGTAGCAATCAGCTCCAAACTCGAGTTTGGAGCTGATTGCTACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000400
VALIDATED
ERCC2 MISSION shRNA Bacterial Glycerol Stock
excision repair cross-complementing rodent repair deficiency, complementation group 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000400.3-1973s21c1
Sequence:CCGGCCAGTTCCAGATTCGTGAGAACTCGAGTTCTCACGAATCTGGAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000400.3-2348s21c1
Sequence:CCGGATAAACGGTTCCTGGTGACTCCTCGAGGAGTCACCAGGAACCGTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000400.3-617s21c1
Sequence:CCGGCCCATACTTCCTTGCTCGATACTCGAGTATCGAGCAAGGAAGTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000400.3-1394s21c1
Sequence:CCGGGCGTTTCCAGTCTGTCATCATCTCGAGATGATGACAGACTGGAAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000400.3-1372s21c1
Sequence:CCGGTGGCCATCAAACCCGTATTTGCTCGAGCAAATACGGGTTTGATGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000400.2-1378s1c1
Sequence:CCGGGCGTTTCCAGTCTGTCATCATCTCGAGATGATGACAGACTGGAAACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000400.2-493s1c1
Sequence:CCGGCTGCCGATTCTATGAGGAATTCTCGAGAATTCCTCATAGAATCGGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000400.2-289s1c1
Sequence:CCGGGCTTCGAAAGTTGCTCAACTTCTCGAGAAGTTGAGCAACTTTCGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000400.2-1957s1c1
Sequence:CCGGCCAGTTCCAGATTCGTGAGAACTCGAGTTCTCACGAATCTGGAACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000400
VALIDATED
ERCC2 MISSION shRNA shRNA Plasmid DNA
excision repair cross-complementing rodent repair deficiency, complementation group 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000400.3-1973s21c1
Sequence:CCGGCCAGTTCCAGATTCGTGAGAACTCGAGTTCTCACGAATCTGGAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000400.3-2348s21c1
Sequence:CCGGATAAACGGTTCCTGGTGACTCCTCGAGGAGTCACCAGGAACCGTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000400.3-617s21c1
Sequence:CCGGCCCATACTTCCTTGCTCGATACTCGAGTATCGAGCAAGGAAGTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000400.3-1394s21c1
Sequence:CCGGGCGTTTCCAGTCTGTCATCATCTCGAGATGATGACAGACTGGAAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000400.3-1372s21c1
Sequence:CCGGTGGCCATCAAACCCGTATTTGCTCGAGCAAATACGGGTTTGATGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000400.2-1378s1c1
Sequence:CCGGGCGTTTCCAGTCTGTCATCATCTCGAGATGATGACAGACTGGAAACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000400.2-493s1c1
Sequence:CCGGCTGCCGATTCTATGAGGAATTCTCGAGAATTCCTCATAGAATCGGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000400.2-289s1c1
Sequence:CCGGGCTTCGAAAGTTGCTCAACTTCTCGAGAAGTTGAGCAACTTTCGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000400.2-1957s1c1
Sequence:CCGGCCAGTTCCAGATTCGTGAGAACTCGAGTTCTCACGAATCTGGAACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000400
VALIDATED
ERCC2 MISSION shRNA Lentiviral Transduction Particles
excision repair cross-complementing rodent repair deficiency, complementation group 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000400.3-1973s21c1
Sequence:CCGGCCAGTTCCAGATTCGTGAGAACTCGAGTTCTCACGAATCTGGAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000400.3-2348s21c1
Sequence:CCGGATAAACGGTTCCTGGTGACTCCTCGAGGAGTCACCAGGAACCGTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000400.3-617s21c1
Sequence:CCGGCCCATACTTCCTTGCTCGATACTCGAGTATCGAGCAAGGAAGTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000400.3-1394s21c1
Sequence:CCGGGCGTTTCCAGTCTGTCATCATCTCGAGATGATGACAGACTGGAAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000400.3-1372s21c1
Sequence:CCGGTGGCCATCAAACCCGTATTTGCTCGAGCAAATACGGGTTTGATGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000400.2-1378s1c1
Sequence:CCGGGCGTTTCCAGTCTGTCATCATCTCGAGATGATGACAGACTGGAAACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000400.2-493s1c1
Sequence:CCGGCTGCCGATTCTATGAGGAATTCTCGAGAATTCCTCATAGAATCGGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000400.2-289s1c1
Sequence:CCGGGCTTCGAAAGTTGCTCAACTTCTCGAGAAGTTGAGCAACTTTCGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000400.2-1957s1c1
Sequence:CCGGCCAGTTCCAGATTCGTGAGAACTCGAGTTCTCACGAATCTGGAACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)