EMAIL THIS PAGE TO A FRIEND

ERI2

ERI1 exoribonuclease family member 2

99 Gene Product Result for
Synonyms: EXOD1
UniProtKB ID: A8K979, Q6ZSJ2, Q96FR9, Q9P224, Q9Y6V3
Gene ID:
Mouse(71151) exoribonuclease 2
Rat(691484) ERI1 exoribonuclease family member 2
sheep(101121562) ERI1 exoribonuclease family member 2
Domestic Rabbit(100345671) ERI1 exoribonuclease family member 2
naked mole-rat(101703293) ERI1 exoribonuclease family member 2
domestic guinea pig(100716580) ERI1 exoribonuclease family member 2
chicken(427000) ERI1 exoribonuclease family member 2
cow(538719) ERI1 exoribonuclease family member 2
Horse(100629745) ERI1 exoribonuclease family member 2
domestic cat(101082712) ERI1 exoribonuclease family member 2
dog(608878) ERI1 exoribonuclease family member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027698 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027698 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027698 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080663 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080663 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080663 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU060051 MISSION® esiRNA esiRNA targeting mouse Exod1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080663 Rosetta Predictions human pricing
XM_001078485 Rosetta Predictions rat pricing
NM_027698 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095468 predicted 889
2 SASI_Hs01_00095469 predicted 377
3 SASI_Hs01_00095470 predicted 1080
4 SASI_Hs01_00095471 predicted 679
5 SASI_Hs01_00095473 predicted 243
6 SASI_Hs01_00095474 predicted 727
7 SASI_Hs01_00095475 predicted 868
8 SASI_Hs01_00095476 predicted 413
9 SASI_Hs01_00095477 predicted 842
10 SASI_Hs02_00362425 predicted 336
11 SASI_Hs01_00095472 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078485 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360927 predicted 200
2 SASI_Rn02_00360928 predicted 850
3 SASI_Rn02_00360929 predicted 325
4 SASI_Rn02_00360930 predicted 459
5 SASI_Rn02_00360931 predicted 558
6 SASI_Rn02_00360932 predicted 670
7 SASI_Rn02_00360933 predicted 845
8 SASI_Rn02_00360934 predicted 512
9 SASI_Rn02_00360935 predicted 574
10 SASI_Rn02_00360936 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027698 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046648 predicted 819
2 SASI_Mm01_00046650 predicted 1292
3 SASI_Mm01_00046651 predicted 1822
4 SASI_Mm01_00046652 predicted 1089
5 SASI_Mm01_00046653 predicted 1296
6 SASI_Mm02_00332595 predicted 1164
7 SASI_Mm02_00332596 predicted 2072
8 SASI_Mm01_00046654 predicted 1131
9 SASI_Mm01_00046655 predicted 1190
10 SASI_Mm01_00046656 predicted 1486
11 SASI_Mm01_00046647 predicted 239
12 SASI_Mm01_00046649 predicted 1593
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027698
VALIDATED
ERI2 MISSION shRNA Bacterial Glycerol Stock
ERI1 exoribonuclease family member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027698.4-966s21c1
Sequence:CCGGCAACATGAAAGCAGATCTTTACTCGAGTAAAGATCTGCTTTCATGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027698.4-2113s21c1
Sequence:CCGGTGCCTTCAGTGTATGTCTTATCTCGAGATAAGACATACACTGAAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027698.4-506s21c1
Sequence:CCGGGCCTAGAGTATGAGTGTAGAACTCGAGTTCTACACTCATACTCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027698.4-565s21c1
Sequence:CCGGATTGATCTCAGAGCAACTTACCTCGAGGTAAGTTGCTCTGAGATCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027698.4-1133s21c1
Sequence:CCGGCAACACTTAACTCCAACTTAGCTCGAGCTAAGTTGGAGTTAAGTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027698.3-2659s1c1
Sequence:CCGGGCCTGGGTACAGATTTAGTTTCTCGAGAAACTAAATCTGTACCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027698.3-1292s1c1
Sequence:CCGGGCCTCCTGTTAGTGACACAAACTCGAGTTTGTGTCACTAACAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027698.3-1823s1c1
Sequence:CCGGGCGGCTTATTGTTTCTAATAACTCGAGTTATTAGAAACAATAAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027698.3-925s1c1
Sequence:CCGGCCTCCTGTATAAAGGGCCAATCTCGAGATTGGCCCTTTATACAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027698.3-499s1c1
Sequence:CCGGGCCTAGAGTATGAGTGTAGAACTCGAGTTCTACACTCATACTCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027698
VALIDATED
ERI2 MISSION shRNA shRNA Plasmid DNA
ERI1 exoribonuclease family member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027698.4-966s21c1
Sequence:CCGGCAACATGAAAGCAGATCTTTACTCGAGTAAAGATCTGCTTTCATGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027698.4-2113s21c1
Sequence:CCGGTGCCTTCAGTGTATGTCTTATCTCGAGATAAGACATACACTGAAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027698.4-506s21c1
Sequence:CCGGGCCTAGAGTATGAGTGTAGAACTCGAGTTCTACACTCATACTCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027698.4-565s21c1
Sequence:CCGGATTGATCTCAGAGCAACTTACCTCGAGGTAAGTTGCTCTGAGATCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027698.4-1133s21c1
Sequence:CCGGCAACACTTAACTCCAACTTAGCTCGAGCTAAGTTGGAGTTAAGTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027698.3-2659s1c1
Sequence:CCGGGCCTGGGTACAGATTTAGTTTCTCGAGAAACTAAATCTGTACCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027698.3-1292s1c1
Sequence:CCGGGCCTCCTGTTAGTGACACAAACTCGAGTTTGTGTCACTAACAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027698.3-1823s1c1
Sequence:CCGGGCGGCTTATTGTTTCTAATAACTCGAGTTATTAGAAACAATAAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027698.3-925s1c1
Sequence:CCGGCCTCCTGTATAAAGGGCCAATCTCGAGATTGGCCCTTTATACAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027698.3-499s1c1
Sequence:CCGGGCCTAGAGTATGAGTGTAGAACTCGAGTTCTACACTCATACTCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027698
VALIDATED
ERI2 MISSION shRNA Lentiviral Transduction Particles
ERI1 exoribonuclease family member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027698.4-966s21c1
Sequence:CCGGCAACATGAAAGCAGATCTTTACTCGAGTAAAGATCTGCTTTCATGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027698.4-2113s21c1
Sequence:CCGGTGCCTTCAGTGTATGTCTTATCTCGAGATAAGACATACACTGAAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027698.4-506s21c1
Sequence:CCGGGCCTAGAGTATGAGTGTAGAACTCGAGTTCTACACTCATACTCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027698.4-565s21c1
Sequence:CCGGATTGATCTCAGAGCAACTTACCTCGAGGTAAGTTGCTCTGAGATCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027698.4-1133s21c1
Sequence:CCGGCAACACTTAACTCCAACTTAGCTCGAGCTAAGTTGGAGTTAAGTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027698.3-2659s1c1
Sequence:CCGGGCCTGGGTACAGATTTAGTTTCTCGAGAAACTAAATCTGTACCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027698.3-1292s1c1
Sequence:CCGGGCCTCCTGTTAGTGACACAAACTCGAGTTTGTGTCACTAACAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027698.3-1823s1c1
Sequence:CCGGGCGGCTTATTGTTTCTAATAACTCGAGTTATTAGAAACAATAAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027698.3-925s1c1
Sequence:CCGGCCTCCTGTATAAAGGGCCAATCTCGAGATTGGCCCTTTATACAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027698.3-499s1c1
Sequence:CCGGGCCTAGAGTATGAGTGTAGAACTCGAGTTCTACACTCATACTCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080663
VALIDATED
ERI2 MISSION shRNA Bacterial Glycerol Stock
ERI1 exoribonuclease family member 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080663.2-1002s21c1
Sequence:CCGGCACAGACTGTTACCACTGAAACTCGAGTTTCAGTGGTAACAGTCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080663.2-1154s21c1
Sequence:CCGGTTGTCATCAAAGGCCCATTTACTCGAGTAAATGGGCCTTTGATGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080663.2-323s21c1
Sequence:CCGGATGGAATTGACAGGCATAAAGCTCGAGCTTTATGCCTGTCAATTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_080663.2-576s21c1
Sequence:CCGGCTTGGATTGATCTCAGAGCAACTCGAGTTGCTCTGAGATCAATCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_080663.2-688s21c1
Sequence:CCGGGTTGGACGATTCTCGGAATACCTCGAGGTATTCCGAGAATCGTCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080663.1-695s1c1
Sequence:CCGGGATTCTCGGAATACTGCCCTTCTCGAGAAGGGCAGTATTCCGAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_080663.1-576s1c1
Sequence:CCGGCTTGGATTGATCTCAGAGCAACTCGAGTTGCTCTGAGATCAATCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_080663.1-1002s1c1
Sequence:CCGGCACAGACTGTTACCACTGAAACTCGAGTTTCAGTGGTAACAGTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_080663.1-274s1c1
Sequence:CCGGCCAGGCTTATGTTCAACCTCACTCGAGTGAGGTTGAACATAAGCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080663.1-87s1c1
Sequence:CCGGGAAAGTCAATTGCGCCAGCAACTCGAGTTGCTGGCGCAATTGACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_080663.1-890s1c1
Sequence:CCGGCCCAATATGAGTAAACAGGAACTCGAGTTCCTGTTTACTCATATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130237    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080663.1-1152s1c1
Sequence:CCGGCTTTGTCATCAAAGGCCCATTCTCGAGAATGGGCCTTTGATGACAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080663
VALIDATED
ERI2 MISSION shRNA shRNA Plasmid DNA
ERI1 exoribonuclease family member 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080663.2-1002s21c1
Sequence:CCGGCACAGACTGTTACCACTGAAACTCGAGTTTCAGTGGTAACAGTCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080663.2-1154s21c1
Sequence:CCGGTTGTCATCAAAGGCCCATTTACTCGAGTAAATGGGCCTTTGATGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080663.2-323s21c1
Sequence:CCGGATGGAATTGACAGGCATAAAGCTCGAGCTTTATGCCTGTCAATTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_080663.2-576s21c1
Sequence:CCGGCTTGGATTGATCTCAGAGCAACTCGAGTTGCTCTGAGATCAATCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_080663.2-688s21c1
Sequence:CCGGGTTGGACGATTCTCGGAATACCTCGAGGTATTCCGAGAATCGTCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080663.1-695s1c1
Sequence:CCGGGATTCTCGGAATACTGCCCTTCTCGAGAAGGGCAGTATTCCGAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_080663.1-576s1c1
Sequence:CCGGCTTGGATTGATCTCAGAGCAACTCGAGTTGCTCTGAGATCAATCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_080663.1-1002s1c1
Sequence:CCGGCACAGACTGTTACCACTGAAACTCGAGTTTCAGTGGTAACAGTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_080663.1-274s1c1
Sequence:CCGGCCAGGCTTATGTTCAACCTCACTCGAGTGAGGTTGAACATAAGCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080663.1-87s1c1
Sequence:CCGGGAAAGTCAATTGCGCCAGCAACTCGAGTTGCTGGCGCAATTGACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_080663.1-890s1c1
Sequence:CCGGCCCAATATGAGTAAACAGGAACTCGAGTTCCTGTTTACTCATATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130237    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080663.1-1152s1c1
Sequence:CCGGCTTTGTCATCAAAGGCCCATTCTCGAGAATGGGCCTTTGATGACAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080663
VALIDATED
ERI2 MISSION shRNA Lentiviral Transduction Particles
ERI1 exoribonuclease family member 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080663.2-1002s21c1
Sequence:CCGGCACAGACTGTTACCACTGAAACTCGAGTTTCAGTGGTAACAGTCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080663.2-1154s21c1
Sequence:CCGGTTGTCATCAAAGGCCCATTTACTCGAGTAAATGGGCCTTTGATGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080663.2-323s21c1
Sequence:CCGGATGGAATTGACAGGCATAAAGCTCGAGCTTTATGCCTGTCAATTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_080663.2-576s21c1
Sequence:CCGGCTTGGATTGATCTCAGAGCAACTCGAGTTGCTCTGAGATCAATCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_080663.2-688s21c1
Sequence:CCGGGTTGGACGATTCTCGGAATACCTCGAGGTATTCCGAGAATCGTCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080663.1-695s1c1
Sequence:CCGGGATTCTCGGAATACTGCCCTTCTCGAGAAGGGCAGTATTCCGAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_080663.1-576s1c1
Sequence:CCGGCTTGGATTGATCTCAGAGCAACTCGAGTTGCTCTGAGATCAATCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_080663.1-1002s1c1
Sequence:CCGGCACAGACTGTTACCACTGAAACTCGAGTTTCAGTGGTAACAGTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_080663.1-274s1c1
Sequence:CCGGCCAGGCTTATGTTCAACCTCACTCGAGTGAGGTTGAACATAAGCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080663.1-87s1c1
Sequence:CCGGGAAAGTCAATTGCGCCAGCAACTCGAGTTGCTGGCGCAATTGACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_080663.1-890s1c1
Sequence:CCGGCCCAATATGAGTAAACAGGAACTCGAGTTCCTGTTTACTCATATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130237    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080663.1-1152s1c1
Sequence:CCGGCTTTGTCATCAAAGGCCCATTCTCGAGAATGGGCCTTTGATGACAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)