EMAIL THIS PAGE TO A FRIEND

ERLEC1

endoplasmic reticulum lectin 1

107 Gene Product Result for
Synonyms: C2orf30 CIM CL24936 CL25084 XTP3-B XTP3TPB
Gene ID:
Human(27248) Summary: This gene encodes a resident endoplasmic reticulum (ER) protein that functions in N-glycan recognition. This protein is thought to be involved in ER-associated degradation via its interaction with the membrane-associated ubiquitin ligase complex. It also functions as a regulator of multiple cellular stress-response pathways in a manner that promotes metastatic cell survival. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 21. [provided by RefSeq, Aug 2011]
Mouse(66753) endoplasmic reticulum lectin 1
Rat(289874) endoplasmic reticulum lectin 1
Zebrafish(368331) endoplasmic reticulum lectin 1
chicken(101665868) endoplasmic reticulum lectin 1
dog(474593) endoplasmic reticulum lectin 1
cow(781454) endoplasmic reticulum lectin 1
domestic cat(101089431) endoplasmic reticulum lectin 1
chicken(101751309) endoplasmic reticulum lectin 1
sheep(101104137) endoplasmic reticulum lectin 1
Domestic Rabbit(100347967) endoplasmic reticulum lectin 1
naked mole-rat(101717524) endoplasmic reticulum lectin 1
domestic guinea pig(100716310) endoplasmic reticulum lectin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015701 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015701 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015701 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025745 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025745 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025745 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127397 Rosetta Predictions human pricing
NM_001127398 Rosetta Predictions human pricing
NM_015701 Rosetta Predictions human pricing
NM_001106023 Rosetta Predictions rat pricing
NM_025745 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329444 predicted 610
2 SASI_Hs02_00329445 predicted 790
3 SASI_Hs02_00329446 predicted 903
4 SASI_Hs02_00329447 predicted 825
5 SASI_Hs02_00329448 predicted 893
6 SASI_Hs02_00329449 predicted 831
7 SASI_Hs02_00329450 predicted 611
8 SASI_Hs02_00329451 predicted 879
9 SASI_Hs02_00329452 predicted 895
10 SASI_Hs02_00329453 predicted 839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329454 predicted 607
2 SASI_Hs02_00329455 predicted 793
3 SASI_Hs02_00329456 predicted 904
4 SASI_Hs02_00329457 predicted 834
5 SASI_Hs02_00329458 predicted 890
6 SASI_Hs02_00329459 predicted 839
7 SASI_Hs02_00329460 predicted 569
8 SASI_Hs02_00329461 predicted 902
9 SASI_Hs02_00329462 predicted 915
10 SASI_Hs02_00329463 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348365 predicted 600
2 SASI_Hs01_00051392 predicted 790
3 SASI_Hs01_00051394 predicted 907
4 SASI_Hs01_00051395 predicted 833
5 SASI_Hs02_00348366 predicted 890
6 SASI_Hs02_00348367 predicted 835
7 SASI_Hs02_00348368 predicted 568
8 SASI_Hs02_00348369 predicted 894
9 SASI_Hs02_00348370 predicted 909
10 SASI_Hs02_00348371 predicted 628
11 SASI_Hs01_00051388 predicted 1290
12 SASI_Hs01_00051389 predicted 1016
13 SASI_Hs01_00051390 predicted 1463
14 SASI_Hs01_00051391 predicted 1144
15 SASI_Hs01_00051393 predicted 810
16 SASI_Hs01_00051396 predicted 1099
17 SASI_Hs01_00051397 predicted 1444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106023 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214862 predicted 1564
2 SASI_Rn02_00214863 predicted 1630
3 SASI_Rn02_00214864 predicted 1415
4 SASI_Rn02_00214865 predicted 1634
5 SASI_Rn02_00214866 predicted 1415
6 SASI_Rn02_00214867 predicted 1586
7 SASI_Rn02_00214868 predicted 1558
8 SASI_Rn02_00214869 predicted 1581
9 SASI_Rn02_00214870 predicted 1598
10 SASI_Rn02_00214871 predicted 1587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025745 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090926 predicted 717
2 SASI_Mm01_00090927 predicted 615
3 SASI_Mm01_00090928 predicted 254
4 SASI_Mm01_00090929 predicted 505
5 SASI_Mm01_00090930 predicted 503
6 SASI_Mm01_00090931 predicted 610
7 SASI_Mm01_00090932 predicted 1319
8 SASI_Mm01_00090933 predicted 932
9 SASI_Mm02_00328934 predicted 928
10 SASI_Mm02_00328935 predicted 564
11 SASI_Mm01_00090934 predicted 730
12 SASI_Mm01_00090935 predicted 889
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015701
VALIDATED
ERLEC1 MISSION shRNA Bacterial Glycerol Stock
endoplasmic reticulum lectin 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015701.3-2025s21c1
Sequence:CCGGGCCTAATCAAATGTCATAATTCTCGAGAATTATGACATTTGATTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015701.3-1632s21c1
Sequence:CCGGAGCCTCACTCCTGTCAATATACTCGAGTATATTGACAGGAGTGAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015701.3-1826s21c1
Sequence:CCGGCTCTTCTAAAGGATGGTATAACTCGAGTTATACCATCCTTTAGAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015701.2-572s1c1
Sequence:CCGGCGAGTACTACCTTGGGAATATCTCGAGATATTCCCAAGGTAGTACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015701.2-1447s1c1
Sequence:CCGGCAGATTCACCTCATGCTGTTACTCGAGTAACAGCATGAGGTGAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015701.2-1286s1c1
Sequence:CCGGGCATATTGAATGGGCTAAGAACTCGAGTTCTTAGCCCATTCAATATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015701.2-1304s1c1
Sequence:CCGGGAAGAATACTGCTAGAGCTTACTCGAGTAAGCTCTAGCAGTATTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015701.2-472s1c1
Sequence:CCGGCCTACAGAATTGAGTCTTATTCTCGAGAATAAGACTCAATTCTGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015701
VALIDATED
ERLEC1 MISSION shRNA shRNA Plasmid DNA
endoplasmic reticulum lectin 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015701.3-2025s21c1
Sequence:CCGGGCCTAATCAAATGTCATAATTCTCGAGAATTATGACATTTGATTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015701.3-1632s21c1
Sequence:CCGGAGCCTCACTCCTGTCAATATACTCGAGTATATTGACAGGAGTGAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015701.3-1826s21c1
Sequence:CCGGCTCTTCTAAAGGATGGTATAACTCGAGTTATACCATCCTTTAGAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015701.2-572s1c1
Sequence:CCGGCGAGTACTACCTTGGGAATATCTCGAGATATTCCCAAGGTAGTACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015701.2-1447s1c1
Sequence:CCGGCAGATTCACCTCATGCTGTTACTCGAGTAACAGCATGAGGTGAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015701.2-1286s1c1
Sequence:CCGGGCATATTGAATGGGCTAAGAACTCGAGTTCTTAGCCCATTCAATATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015701.2-1304s1c1
Sequence:CCGGGAAGAATACTGCTAGAGCTTACTCGAGTAAGCTCTAGCAGTATTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015701.2-472s1c1
Sequence:CCGGCCTACAGAATTGAGTCTTATTCTCGAGAATAAGACTCAATTCTGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015701
VALIDATED
ERLEC1 MISSION shRNA Lentiviral Transduction Particles
endoplasmic reticulum lectin 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015701.3-2025s21c1
Sequence:CCGGGCCTAATCAAATGTCATAATTCTCGAGAATTATGACATTTGATTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015701.3-1632s21c1
Sequence:CCGGAGCCTCACTCCTGTCAATATACTCGAGTATATTGACAGGAGTGAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015701.3-1826s21c1
Sequence:CCGGCTCTTCTAAAGGATGGTATAACTCGAGTTATACCATCCTTTAGAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015701.2-572s1c1
Sequence:CCGGCGAGTACTACCTTGGGAATATCTCGAGATATTCCCAAGGTAGTACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015701.2-1447s1c1
Sequence:CCGGCAGATTCACCTCATGCTGTTACTCGAGTAACAGCATGAGGTGAATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015701.2-1286s1c1
Sequence:CCGGGCATATTGAATGGGCTAAGAACTCGAGTTCTTAGCCCATTCAATATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015701.2-1304s1c1
Sequence:CCGGGAAGAATACTGCTAGAGCTTACTCGAGTAAGCTCTAGCAGTATTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015701.2-472s1c1
Sequence:CCGGCCTACAGAATTGAGTCTTATTCTCGAGAATAAGACTCAATTCTGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025745
VALIDATED
ERLEC1 MISSION shRNA Bacterial Glycerol Stock
endoplasmic reticulum lectin 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000193402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025745.2-250s1c1
Sequence:CCGGCATCATGACAACTGCTCATAACTCGAGTTATGAGCAGTTGTCATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025745.2-694s1c1
Sequence:CCGGCCATCCTGAATCTAAGCATGACTCGAGTCATGCTTAGATTCAGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025745.2-728s1c1
Sequence:CCGGGCTGAAGTTACAACTTGTGAACTCGAGTTCACAAGTTGTAACTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025745.2-1238s1c1
Sequence:CCGGGCGTATCATCTTCAAGACGATCTCGAGATCGTCTTGAAGATGATACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025745
VALIDATED
ERLEC1 MISSION shRNA shRNA Plasmid DNA
endoplasmic reticulum lectin 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000193402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025745.2-250s1c1
Sequence:CCGGCATCATGACAACTGCTCATAACTCGAGTTATGAGCAGTTGTCATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025745.2-694s1c1
Sequence:CCGGCCATCCTGAATCTAAGCATGACTCGAGTCATGCTTAGATTCAGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025745.2-728s1c1
Sequence:CCGGGCTGAAGTTACAACTTGTGAACTCGAGTTCACAAGTTGTAACTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025745.2-1238s1c1
Sequence:CCGGGCGTATCATCTTCAAGACGATCTCGAGATCGTCTTGAAGATGATACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025745
VALIDATED
ERLEC1 MISSION shRNA Lentiviral Transduction Particles
endoplasmic reticulum lectin 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000193402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025745.2-250s1c1
Sequence:CCGGCATCATGACAACTGCTCATAACTCGAGTTATGAGCAGTTGTCATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025745.2-694s1c1
Sequence:CCGGCCATCCTGAATCTAAGCATGACTCGAGTCATGCTTAGATTCAGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025745.2-728s1c1
Sequence:CCGGGCTGAAGTTACAACTTGTGAACTCGAGTTCACAAGTTGTAACTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025745.2-1238s1c1
Sequence:CCGGGCGTATCATCTTCAAGACGATCTCGAGATCGTCTTGAAGATGATACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)