ERN1

endoplasmic reticulum to nucleus signaling 1

80 Gene Product Result for

Synonyms: IRE1 IRE1P IRE1a hIRE1p

Species: Human ERN1(2081), Mouse Ern1(78943), Rat Ern1(498013), sheep ERN1(101102746), naked mole-rat Ern1(101714734), domestic guinea pig Ern1(100733391), Zebrafish ern1(553551), chicken ERN1(771230), cow ERN1(524719), Horse ERN1(100064339), domestic cat ERN1(101084148), dog ERN1(610766)

UniProtKB ID: O75460, A1L457, A8K8N8, A8MXS7, Q59EE2

Gene ID:

Human(2081) Summary: The protein encoded by this gene is the ER to nucleus signalling 1 protein, a human homologue of the yeast Ire1 gene product. This protein possesses intrinsic kinase activity and an endoribonuclease activity and it is important in altering gene expression as a response to endoplasmic reticulum-based stress signals. [provided by RefSeq, Jul 2008]

Mouse(78943) endoplasmic reticulum (ER) to nucleus signalling 1

Rat(498013) endoplasmic reticulum to nucleus signaling 1

sheep(101102746) endoplasmic reticulum to nucleus signaling 1

naked mole-rat(101714734) endoplasmic reticulum to nucleus signaling 1

domestic guinea pig(100733391) endoplasmic reticulum to nucleus signaling 1

Zebrafish(553551) endoplasmic reticulum to nucleus signaling 1

chicken(771230) endoplasmic reticulum to nucleus signaling 1

cow(524719) endoplasmic reticulum to nucleus signaling 1

Horse(100064339) endoplasmic reticulum to nucleus signaling 1

domestic cat(101084148) endoplasmic reticulum to nucleus signaling 1

dog(610766) endoplasmic reticulum to nucleus signaling 1

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

SAB1412645	ANTI-ERN1 antibody produced in mouse clone 4D12, purified immunoglobulin, buffered aqueous solution	human	ELISA, western blot	pricing

SAB1412028	ANTI-ERN1 antibody produced in mouse clone 5F3, purified immunoglobulin, buffered aqueous solution	human	ELISA, western blot	pricing

SAB1412029	ANTI-ERN1 antibody produced in mouse clone 6G11, purified immunoglobulin, buffered aqueous solution	human	ELISA, western blot	pricing

SAB1412341	ANTI-ERN1 antibody produced in mouse clone 4E1, purified immunoglobulin, buffered aqueous solution	human	ELISA, western blot	pricing

HPA027730	Anti-ERN1 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunohistochemistry	pricing

SAB2500366	Anti-ERN1/IRE1A antibody produced in goat affinity isolated antibody, buffered aqueous solution	rat, canine, human, mouse	ELISA, western blot	pricing

I6785	Anti-IRE1α antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution	human	immunofluorescence, immunoprecipitation (IP), western blot	pricing

PRS3655	Anti-IRE1P (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution	rat, mouse, human	ELISA, immunocytochemistry, immunofluorescence, western blot	pricing

PRS3657	Anti-IRE1P (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution	mouse, rat, human	ELISA, immunocytochemistry, immunofluorescence, western blot	pricing

PRS3659	Anti-IRE1P (ab3) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution	human	ELISA, western blot	pricing

SAB5700519	Anti-Phospho-IRE1alpha-S724 antibody produced in rabbit	mouse, rat, human	immunohistochemistry, western blot	pricing

SAB1413150	Monoclonal Anti-ERN1 (phospho S724) antibody produced in rabbit clone EGH-5	human	western blot	pricing

SAB1403792	Monoclonal Anti-ERN1 antibody produced in mouse clone 3D1, purified immunoglobulin, buffered aqueous solution	human	ELISA, immunohistochemistry, western blot	pricing

WH0002081M2	Monoclonal Anti-ERN1 antibody produced in mouse clone 8D12, purified immunoglobulin, buffered aqueous solution	human	ELISA, immunofluorescence, proximity ligation assay, western blot	pricing

Proteins

Product #	Description	Species	Add to Cart

APREST72283	PrEST Antigen ERN1 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST21707	SILu^™PrEST ERN1 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

3'UTR GoClone

Product #	Description	Species	Add to Cart

HUTR08659	MISSION^® 3′UTR Lenti GoClone^™ Powered by SwitchGear Genomics^™, 3′UTR, human, ERN1	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_001433	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_001433	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_001433	MISSION® shRNA Lentiviral Transduction Particles	human	pricing
SHCLNG-NM_023913	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_023913	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_023913	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU002721	MISSION^® esiRNA targeting human ERN1	human	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_001433	Rosetta Predictions	human	pricing
NM_152461	Rosetta Predictions	human	pricing
XM_001081576	Rosetta Predictions	rat	pricing
XM_573211	Rosetta Predictions	rat	pricing
NM_023913	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001433	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00194923 predicted	2768
2	SASI_Hs01_00194924 predicted	539
3	SASI_Hs02_00331841 predicted	2512
4	SASI_Hs01_00194927 predicted	1222
5	SASI_Hs01_00194928 predicted	2782
6	SASI_Hs02_00331842 predicted	1126
7	SASI_Hs01_00194929 predicted	516
8	SASI_Hs01_00194930 predicted	2325
9	SASI_Hs02_00331843 predicted	641
10	SASI_Hs01_00194932 predicted	453
11	SASI_Hs01_00194925 predicted	941
12	SASI_Hs01_00194926 predicted	2479
13	SASI_Hs01_00194931 predicted	2147

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_152461	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00026921 predicted	780
2	SASI_Hs01_00026922 predicted	781
3	SASI_Hs01_00026923 predicted	780
4	SASI_Hs01_00026924 predicted	777
5	SASI_Hs01_00026925 predicted	784
6	SASI_Hs01_00026926 predicted	592
7	SASI_Hs01_00026927 predicted	602
8	SASI_Hs01_00026928 predicted	1080
9	SASI_Hs01_00026929 predicted	1246
10	SASI_Hs01_00026930 predicted	1162

siRNA

PRODUCT #	siRNA Type ?	SPECIES
XM_001081576	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00372535 predicted	1677
2	SASI_Rn02_00372536 predicted	1692
3	SASI_Rn02_00372537 predicted	631
4	SASI_Rn02_00372538 predicted	838
5	SASI_Rn02_00372539 predicted	811
6	SASI_Rn02_00372540 predicted	1542
7	SASI_Rn02_00372541 predicted	2341
8	SASI_Rn02_00372542 predicted	816
9	SASI_Rn02_00372543 predicted	3500
10	SASI_Rn02_00372544 predicted	748

siRNA

PRODUCT #	siRNA Type ?	SPECIES
XM_573211	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00400004 predicted	1158
2	SASI_Rn02_00400005 predicted	1180
3	SASI_Rn02_00400006 predicted	327
4	SASI_Rn02_00400007 predicted	293
5	SASI_Rn02_00400008 predicted	983
6	SASI_Rn02_00400009 predicted	1036
7	SASI_Rn02_00400010 predicted	1099
8	SASI_Rn02_00400011 predicted	297
9	SASI_Rn02_00400012 predicted	302
10	SASI_Rn02_00400013 predicted	329

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_023913	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00042550 predicted	567
2	SASI_Mm01_00042551 predicted	350
3	SASI_Mm01_00042552 predicted	483
4	SASI_Mm01_00042553 predicted	464
5	SASI_Mm01_00042554 predicted	970
6	SASI_Mm01_00042555 predicted	3139
7	SASI_Mm01_00042556 predicted	1185
8	SASI_Mm01_00042557 predicted	1139
9	SASI_Mm01_00042558 predicted	1984
10	SASI_Mm01_00042559 predicted	1259

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_001433 VALIDATED	ERN1 MISSION shRNA Bacterial Glycerol Stock endoplasmic reticulum to nucleus signaling 1	Human

20 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000368442
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-2014s21c1
	Sequence:CCGGACCGGCAATTCCAGTACATTGCTCGAGCAATGTACTGGAATTGCCGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000356311
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-453s21c1
	Sequence:CCGGGGAATCCTCTACATGGGTAAACTCGAGTTTACCCATGTAGAGGATTCCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000356308
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_001433.3-3090s21c1
	Sequence:CCGGAGGGCCTGGTCACCACAATTACTCGAGTAATTGTGGTGACCAGGCCCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000356305
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-219s21c1
	Sequence:CCGGTCAACGCTGGATGGAAGTTTGCTCGAGCAAACTTCCATCCAGCGTTGATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000235528
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-363s21c1
	Sequence:CCGGACGCTTGGAAGCAAGAATAATCTCGAGATTATTCTTGCTTCCAAGCGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000235530
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-1849s21c1
	Sequence:CCGGATGGAGCTGAGGGCACAATTGCTCGAGCAATTGTGCCCTCAGCTCCATTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195378
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_001433.2-3344s1c1
	Sequence:CCGGCCTGCTTAATGTCAGTCTACACTCGAGTGTAGACTGACATTAAGCAGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199739
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_001433.2-3063s1c1
	Sequence:CCGGGAGGGCCTGGTCACCACAATTCTCGAGAATTGTGGTGACCAGGCCCTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000235531
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-263s21c1
	Sequence:CCGGCTCAATCAAATGGACTTTAAACTCGAGTTTAAAGTCCATTTGATTGAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000235529
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_001433.3-3407s21c1
	Sequence:CCGGAGAGGAGGGAATCGTACATTTCTCGAGAAATGTACGATTCCCTCCTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000235527
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-2771s21c1
	Sequence:CCGGGCGTAAATTCAGGACCTATAACTCGAGTTATAGGTCCTGAATTTACGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000356306
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-2230s21c1
	Sequence:CCGGAGGCCATGATCTCCGACTTTGCTCGAGCAAAGTCGGAGATCATGGCCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000356309
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_001433.3-3473s21c1
	Sequence:CCGGCTTCACTGGAGACCGGAATTGCTCGAGCAATTCCGGTCTCCAGTGAAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196689
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001433.2-1140s1c1
	Sequence:CCGGGCTCAACTACTTGAGGAATTACTCGAGTAATTCCTCAAGTAGTTGAGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000356310
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-476s21c1
	Sequence:CCGGGCAGGACATCTGGTATGTTATCTCGAGATAACATACCAGATGTCCTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000356307
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-2506s21c1
	Sequence:CCGGAGAAGCACGAAGACGTCATTGCTCGAGCAATGACGTCTTCGTGCTTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000532
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001433.x-957s1c1
	Sequence:CCGGGAAATACTCTACCAGCCTCTACTCGAGTAGAGGCTGGTAGAGTATTTCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000530
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001433.x-2524s1c1
	Sequence:CCGGGAGAAGATGATTGCGATGGATCTCGAGATCCATCGCAATCATCTTCTCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000529
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: A549
	TRC Version: 1	Clone ID:NM_001433.x-540s1c1
	Sequence:CCGGCCCATCAACCTCTCTTCTGTACTCGAGTACAGAAGAGAGGTTGATGGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000528
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_001433.x-3319s1c1
	Sequence:CCGGCTACTGGATAAACTTGCTTCACTCGAGTGAAGCAAGTTTATCCAGTAGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_001433 VALIDATED	ERN1 MISSION shRNA shRNA Plasmid DNA endoplasmic reticulum to nucleus signaling 1	Human

20 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000368442
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-2014s21c1
	Sequence:CCGGACCGGCAATTCCAGTACATTGCTCGAGCAATGTACTGGAATTGCCGGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000356311
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-453s21c1
	Sequence:CCGGGGAATCCTCTACATGGGTAAACTCGAGTTTACCCATGTAGAGGATTCCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000356308
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_001433.3-3090s21c1
	Sequence:CCGGAGGGCCTGGTCACCACAATTACTCGAGTAATTGTGGTGACCAGGCCCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000356305
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-219s21c1
	Sequence:CCGGTCAACGCTGGATGGAAGTTTGCTCGAGCAAACTTCCATCCAGCGTTGATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000235528
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-363s21c1
	Sequence:CCGGACGCTTGGAAGCAAGAATAATCTCGAGATTATTCTTGCTTCCAAGCGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000235530
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-1849s21c1
	Sequence:CCGGATGGAGCTGAGGGCACAATTGCTCGAGCAATTGTGCCCTCAGCTCCATTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000195378
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_001433.2-3344s1c1
	Sequence:CCGGCCTGCTTAATGTCAGTCTACACTCGAGTGTAGACTGACATTAAGCAGGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000199739
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_001433.2-3063s1c1
	Sequence:CCGGGAGGGCCTGGTCACCACAATTCTCGAGAATTGTGGTGACCAGGCCCTCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000235531
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-263s21c1
	Sequence:CCGGCTCAATCAAATGGACTTTAAACTCGAGTTTAAAGTCCATTTGATTGAGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000235529
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_001433.3-3407s21c1
	Sequence:CCGGAGAGGAGGGAATCGTACATTTCTCGAGAAATGTACGATTCCCTCCTCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000235527
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-2771s21c1
	Sequence:CCGGGCGTAAATTCAGGACCTATAACTCGAGTTATAGGTCCTGAATTTACGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000356306
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-2230s21c1
	Sequence:CCGGAGGCCATGATCTCCGACTTTGCTCGAGCAAAGTCGGAGATCATGGCCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000356309
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_001433.3-3473s21c1
	Sequence:CCGGCTTCACTGGAGACCGGAATTGCTCGAGCAATTCCGGTCTCCAGTGAAGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000196689
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001433.2-1140s1c1
	Sequence:CCGGGCTCAACTACTTGAGGAATTACTCGAGTAATTCCTCAAGTAGTTGAGCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000356310
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-476s21c1
	Sequence:CCGGGCAGGACATCTGGTATGTTATCTCGAGATAACATACCAGATGTCCTGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000356307
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-2506s21c1
	Sequence:CCGGAGAAGCACGAAGACGTCATTGCTCGAGCAATGACGTCTTCGTGCTTCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000000532
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001433.x-957s1c1
	Sequence:CCGGGAAATACTCTACCAGCCTCTACTCGAGTAGAGGCTGGTAGAGTATTTCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000000530
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001433.x-2524s1c1
	Sequence:CCGGGAGAAGATGATTGCGATGGATCTCGAGATCCATCGCAATCATCTTCTCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000000529
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: A549
	TRC Version: 1	Clone ID:NM_001433.x-540s1c1
	Sequence:CCGGCCCATCAACCTCTCTTCTGTACTCGAGTACAGAAGAGAGGTTGATGGGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000000528
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_001433.x-3319s1c1
	Sequence:CCGGCTACTGGATAAACTTGCTTCACTCGAGTGAAGCAAGTTTATCCAGTAGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_001433 VALIDATED	ERN1 MISSION shRNA Lentiviral Transduction Particles endoplasmic reticulum to nucleus signaling 1	Human

20 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000368442
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-2014s21c1
	Sequence:CCGGACCGGCAATTCCAGTACATTGCTCGAGCAATGTACTGGAATTGCCGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000356311
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-453s21c1
	Sequence:CCGGGGAATCCTCTACATGGGTAAACTCGAGTTTACCCATGTAGAGGATTCCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000356308
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_001433.3-3090s21c1
	Sequence:CCGGAGGGCCTGGTCACCACAATTACTCGAGTAATTGTGGTGACCAGGCCCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000356305
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-219s21c1
	Sequence:CCGGTCAACGCTGGATGGAAGTTTGCTCGAGCAAACTTCCATCCAGCGTTGATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000235528
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-363s21c1
	Sequence:CCGGACGCTTGGAAGCAAGAATAATCTCGAGATTATTCTTGCTTCCAAGCGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000235530
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-1849s21c1
	Sequence:CCGGATGGAGCTGAGGGCACAATTGCTCGAGCAATTGTGCCCTCAGCTCCATTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195378
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_001433.2-3344s1c1
	Sequence:CCGGCCTGCTTAATGTCAGTCTACACTCGAGTGTAGACTGACATTAAGCAGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199739
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_001433.2-3063s1c1
	Sequence:CCGGGAGGGCCTGGTCACCACAATTCTCGAGAATTGTGGTGACCAGGCCCTCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000235531
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-263s21c1
	Sequence:CCGGCTCAATCAAATGGACTTTAAACTCGAGTTTAAAGTCCATTTGATTGAGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000235529
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_001433.3-3407s21c1
	Sequence:CCGGAGAGGAGGGAATCGTACATTTCTCGAGAAATGTACGATTCCCTCCTCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000235527
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-2771s21c1
	Sequence:CCGGGCGTAAATTCAGGACCTATAACTCGAGTTATAGGTCCTGAATTTACGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000356306
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-2230s21c1
	Sequence:CCGGAGGCCATGATCTCCGACTTTGCTCGAGCAAAGTCGGAGATCATGGCCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000356309
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_001433.3-3473s21c1
	Sequence:CCGGCTTCACTGGAGACCGGAATTGCTCGAGCAATTCCGGTCTCCAGTGAAGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196689
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001433.2-1140s1c1
	Sequence:CCGGGCTCAACTACTTGAGGAATTACTCGAGTAATTCCTCAAGTAGTTGAGCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000356310
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-476s21c1
	Sequence:CCGGGCAGGACATCTGGTATGTTATCTCGAGATAACATACCAGATGTCCTGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000356307
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001433.3-2506s21c1
	Sequence:CCGGAGAAGCACGAAGACGTCATTGCTCGAGCAATGACGTCTTCGTGCTTCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000532
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001433.x-957s1c1
	Sequence:CCGGGAAATACTCTACCAGCCTCTACTCGAGTAGAGGCTGGTAGAGTATTTCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000530
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001433.x-2524s1c1
	Sequence:CCGGGAGAAGATGATTGCGATGGATCTCGAGATCCATCGCAATCATCTTCTCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000529
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: A549
	TRC Version: 1	Clone ID:NM_001433.x-540s1c1
	Sequence:CCGGCCCATCAACCTCTCTTCTGTACTCGAGTACAGAAGAGAGGTTGATGGGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000528
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_001433.x-3319s1c1
	Sequence:CCGGCTACTGGATAAACTTGCTTCACTCGAGTGAAGCAAGTTTATCCAGTAGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_023913 VALIDATED	ERN1 MISSION shRNA Bacterial Glycerol Stock endoplasmic reticulum to nucleus signaling 1	Mouse

10 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000232022
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_023913.2-1448s21c1
	Sequence:CCGGTCAAGGACATGGCTACCATTACTCGAGTAATGGTAGCCATGTCCTTGATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232025
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_023913.2-2767s21c1
	Sequence:CCGGCAGACAGATCTGCGCAAATTCCTCGAGGAATTTGCGCAGATCTGTCTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232026
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.55	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_023913.2-3710s21c1
	Sequence:CCGGCCAGCACAGTGGCCTAAATAGCTCGAGCTATTTAGGCCACTGTGCTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232024
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_023913.2-2513s21c1
	Sequence:CCGGACAAGCATGAGGACGTCATTGCTCGAGCAATGACGTCCTCATGCTTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232023
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_023913.2-1856s21c1
	Sequence:CCGGATGGAGCTGAGGGCACAATTGCTCGAGCAATTGTGCCCTCAGCTCCATTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000008424
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.69	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_023913.2-3361s1c1
	Sequence:CCGGCCCACTTCTCTTTCTTTCTAACTCGAGTTAGAAAGAAAGAGAAGTGGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000008425
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_023913.2-2533s1c1
	Sequence:CCGGGCTCGTGAATTGATAGAGAAACTCGAGTTTCTCTATCAATTCACGAGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000008427
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_023913.2-1179s1c1
	Sequence:CCGGGCTGAACTACTTGAGGAATTACTCGAGTAATTCCTCAAGTAGTTCAGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000008428
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_023913.2-1987s1c1
	Sequence:CCGGCCAAATGTGATCCGCTACTTTCTCGAGAAAGTAGCGGATCACATTTGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000008426
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_023913.2-401s1c1
	Sequence:CCGGGCCTGACGAAACTTCCCTTTACTCGAGTAAAGGGAAGTTTCGTCAGGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_023913 VALIDATED	ERN1 MISSION shRNA shRNA Plasmid DNA endoplasmic reticulum to nucleus signaling 1	Mouse

10 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000232022
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_023913.2-1448s21c1
	Sequence:CCGGTCAAGGACATGGCTACCATTACTCGAGTAATGGTAGCCATGTCCTTGATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000232025
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_023913.2-2767s21c1
	Sequence:CCGGCAGACAGATCTGCGCAAATTCCTCGAGGAATTTGCGCAGATCTGTCTGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000232026
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.55	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_023913.2-3710s21c1
	Sequence:CCGGCCAGCACAGTGGCCTAAATAGCTCGAGCTATTTAGGCCACTGTGCTGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000232024
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_023913.2-2513s21c1
	Sequence:CCGGACAAGCATGAGGACGTCATTGCTCGAGCAATGACGTCCTCATGCTTGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000232023
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_023913.2-1856s21c1
	Sequence:CCGGATGGAGCTGAGGGCACAATTGCTCGAGCAATTGTGCCCTCAGCTCCATTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000008424
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.69	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_023913.2-3361s1c1
	Sequence:CCGGCCCACTTCTCTTTCTTTCTAACTCGAGTTAGAAAGAAAGAGAAGTGGGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000008425
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_023913.2-2533s1c1
	Sequence:CCGGGCTCGTGAATTGATAGAGAAACTCGAGTTTCTCTATCAATTCACGAGCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000008427
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_023913.2-1179s1c1
	Sequence:CCGGGCTGAACTACTTGAGGAATTACTCGAGTAATTCCTCAAGTAGTTCAGCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000008428
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_023913.2-1987s1c1
	Sequence:CCGGCCAAATGTGATCCGCTACTTTCTCGAGAAAGTAGCGGATCACATTTGGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000008426
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_023913.2-401s1c1
	Sequence:CCGGGCCTGACGAAACTTCCCTTTACTCGAGTAAAGGGAAGTTTCGTCAGGCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_023913 VALIDATED	ERN1 MISSION shRNA Lentiviral Transduction Particles endoplasmic reticulum to nucleus signaling 1	Mouse

10 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000232022
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_023913.2-1448s21c1
	Sequence:CCGGTCAAGGACATGGCTACCATTACTCGAGTAATGGTAGCCATGTCCTTGATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232025
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_023913.2-2767s21c1
	Sequence:CCGGCAGACAGATCTGCGCAAATTCCTCGAGGAATTTGCGCAGATCTGTCTGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232026
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.55	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_023913.2-3710s21c1
	Sequence:CCGGCCAGCACAGTGGCCTAAATAGCTCGAGCTATTTAGGCCACTGTGCTGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232024
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_023913.2-2513s21c1
	Sequence:CCGGACAAGCATGAGGACGTCATTGCTCGAGCAATGACGTCCTCATGCTTGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232023
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_023913.2-1856s21c1
	Sequence:CCGGATGGAGCTGAGGGCACAATTGCTCGAGCAATTGTGCCCTCAGCTCCATTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000008424
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.69	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_023913.2-3361s1c1
	Sequence:CCGGCCCACTTCTCTTTCTTTCTAACTCGAGTTAGAAAGAAAGAGAAGTGGGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000008425
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_023913.2-2533s1c1
	Sequence:CCGGGCTCGTGAATTGATAGAGAAACTCGAGTTTCTCTATCAATTCACGAGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000008427
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_023913.2-1179s1c1
	Sequence:CCGGGCTGAACTACTTGAGGAATTACTCGAGTAATTCCTCAAGTAGTTCAGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000008428
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.61	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_023913.2-1987s1c1
	Sequence:CCGGCCAAATGTGATCCGCTACTTTCTCGAGAAAGTAGCGGATCACATTTGGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000008426
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_023913.2-401s1c1
	Sequence:CCGGGCCTGACGAAACTTCCCTTTACTCGAGTAAAGGGAAGTTTCGTCAGGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart