EMAIL THIS PAGE TO A FRIEND

ERO1LB

ERO1-like beta (S. cerevisiae)

78 Gene Product Result for
UniProtKB ID: Q86YB8, Q5T1H4, Q8IZ11, Q9NR62
Gene ID:
Mouse(67475) ERO1-like beta (S. cerevisiae)
Rat(364755) ERO1-like beta (S. cerevisiae)
domestic guinea pig(100732589) ERO1-like beta (S. cerevisiae)
naked mole-rat(101723382) ERO1-like beta (S. cerevisiae)
sheep(101117988) ERO1-like beta (S. cerevisiae)
Zebrafish(767700) ERO1-like beta (S. cerevisiae)
chicken(421509) ERO1-like beta (S. cerevisiae)
cow(514361) ERO1-like beta (S. cerevisiae)
Horse(100050567) ERO1-like beta (S. cerevisiae)
domestic cat(101080662) ERO1-like beta (S. cerevisiae)
dog(488956) ERO1-like beta (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026184 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026184 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026184 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019891 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019891 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019891 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084511 MISSION® esiRNA esiRNA human ERO1LB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019891 Rosetta Predictions human pricing
XM_001054206 Rosetta Predictions rat pricing
XM_344618 Rosetta Predictions rat pricing
NM_026184 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352900 predicted 1365
2 SASI_Hs02_00352901 predicted 1283
3 SASI_Hs02_00352902 predicted 1632
4 SASI_Hs01_00126045 predicted 812
5 SASI_Hs01_00126046 predicted 972
6 SASI_Hs02_00352903 predicted 1328
7 SASI_Hs01_00126049 predicted 1195
8 SASI_Hs01_00126050 predicted 1468
9 SASI_Hs02_00352904 predicted 1245
10 SASI_Hs02_00352905 predicted 1143
11 SASI_Hs01_00126044 predicted 585
12 SASI_Hs01_00126047 predicted 410
13 SASI_Hs01_00126048 predicted 318
14 SASI_Hs01_00126051 predicted 332
15 SASI_Hs01_00126052 predicted 1440
16 SASI_Hs01_00126053 predicted 962
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054206 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275077 predicted 1152
2 SASI_Rn02_00275078 predicted 892
3 SASI_Rn02_00275079 predicted 319
4 SASI_Rn02_00275080 predicted 589
5 SASI_Rn02_00275081 predicted 1412
6 SASI_Rn02_00275082 predicted 918
7 SASI_Rn02_00275083 predicted 1018
8 SASI_Rn02_00275084 predicted 640
9 SASI_Rn02_00275085 predicted 1085
10 SASI_Rn02_00275086 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344618 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397318 predicted 1158
2 SASI_Rn02_00397319 predicted 898
3 SASI_Rn02_00397320 predicted 320
4 SASI_Rn02_00397321 predicted 582
5 SASI_Rn02_00397322 predicted 921
6 SASI_Rn02_00397323 predicted 1017
7 SASI_Rn02_00397324 predicted 644
8 SASI_Rn02_00397325 predicted 1087
9 SASI_Rn02_00397326 predicted 1373
10 SASI_Rn02_00397327 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026184 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092372 predicted 896
2 SASI_Mm01_00092373 predicted 1360
3 SASI_Mm02_00329826 predicted 1018
4 SASI_Mm01_00092374 predicted 1311
5 SASI_Mm01_00092375 predicted 1269
6 SASI_Mm01_00092376 predicted 920
7 SASI_Mm01_00092377 predicted 1036
8 SASI_Mm01_00092378 predicted 1090
9 SASI_Mm01_00092379 predicted 1159
10 SASI_Mm01_00092380 predicted 640
11 SASI_Mm01_00092381 predicted 567
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026184
VALIDATED
ERO1LB MISSION shRNA Bacterial Glycerol Stock
ERO1-like beta (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026184.2-3155s1c1
Sequence:CCGGCCCATTTAGAATGTAAGGAAACTCGAGTTTCCTTACATTCTAAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026184.2-1325s1c1
Sequence:CCGGCCGGTTACATTTCAAGAACATCTCGAGATGTTCTTGAAATGTAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026184.2-825s1c1
Sequence:CCGGCGATCTGTTTATCGTCCTTTACTCGAGTAAAGGACGATAAACAGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026184.2-1162s1c1
Sequence:CCGGGCTCGATTGTTGATCTCTATACTCGAGTATAGAGATCAACAATCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026184.2-1161s1c1
Sequence:CCGGCGCTCGATTGTTGATCTCTATCTCGAGATAGAGATCAACAATCGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026184.2-1816s21c1
Sequence:CCGGTGCCATGTTTGTTTCACATTTCTCGAGAAATGTGAAACAAACATGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026184.2-1325s21c1
Sequence:CCGGCCGGTTACATTTCAAGAACATCTCGAGATGTTCTTGAAATGTAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026184.2-1162s21c1
Sequence:CCGGGCTCGATTGTTGATCTCTATACTCGAGTATAGAGATCAACAATCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026184.2-825s21c1
Sequence:CCGGCGATCTGTTTATCGTCCTTTACTCGAGTAAAGGACGATAAACAGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026184.2-403s21c1
Sequence:CCGGTTCGTTATTACAAGGTTAATCCTCGAGGATTAACCTTGTAATAACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026184
VALIDATED
ERO1LB MISSION shRNA shRNA Plasmid DNA
ERO1-like beta (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026184.2-3155s1c1
Sequence:CCGGCCCATTTAGAATGTAAGGAAACTCGAGTTTCCTTACATTCTAAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026184.2-1325s1c1
Sequence:CCGGCCGGTTACATTTCAAGAACATCTCGAGATGTTCTTGAAATGTAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026184.2-825s1c1
Sequence:CCGGCGATCTGTTTATCGTCCTTTACTCGAGTAAAGGACGATAAACAGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026184.2-1162s1c1
Sequence:CCGGGCTCGATTGTTGATCTCTATACTCGAGTATAGAGATCAACAATCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026184.2-1161s1c1
Sequence:CCGGCGCTCGATTGTTGATCTCTATCTCGAGATAGAGATCAACAATCGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026184.2-1816s21c1
Sequence:CCGGTGCCATGTTTGTTTCACATTTCTCGAGAAATGTGAAACAAACATGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026184.2-1325s21c1
Sequence:CCGGCCGGTTACATTTCAAGAACATCTCGAGATGTTCTTGAAATGTAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026184.2-1162s21c1
Sequence:CCGGGCTCGATTGTTGATCTCTATACTCGAGTATAGAGATCAACAATCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026184.2-825s21c1
Sequence:CCGGCGATCTGTTTATCGTCCTTTACTCGAGTAAAGGACGATAAACAGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026184.2-403s21c1
Sequence:CCGGTTCGTTATTACAAGGTTAATCCTCGAGGATTAACCTTGTAATAACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026184
VALIDATED
ERO1LB MISSION shRNA Lentiviral Transduction Particles
ERO1-like beta (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026184.2-3155s1c1
Sequence:CCGGCCCATTTAGAATGTAAGGAAACTCGAGTTTCCTTACATTCTAAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026184.2-1325s1c1
Sequence:CCGGCCGGTTACATTTCAAGAACATCTCGAGATGTTCTTGAAATGTAACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026184.2-825s1c1
Sequence:CCGGCGATCTGTTTATCGTCCTTTACTCGAGTAAAGGACGATAAACAGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026184.2-1162s1c1
Sequence:CCGGGCTCGATTGTTGATCTCTATACTCGAGTATAGAGATCAACAATCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026184.2-1161s1c1
Sequence:CCGGCGCTCGATTGTTGATCTCTATCTCGAGATAGAGATCAACAATCGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026184.2-1816s21c1
Sequence:CCGGTGCCATGTTTGTTTCACATTTCTCGAGAAATGTGAAACAAACATGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026184.2-1325s21c1
Sequence:CCGGCCGGTTACATTTCAAGAACATCTCGAGATGTTCTTGAAATGTAACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026184.2-1162s21c1
Sequence:CCGGGCTCGATTGTTGATCTCTATACTCGAGTATAGAGATCAACAATCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026184.2-825s21c1
Sequence:CCGGCGATCTGTTTATCGTCCTTTACTCGAGTAAAGGACGATAAACAGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026184.2-403s21c1
Sequence:CCGGTTCGTTATTACAAGGTTAATCCTCGAGGATTAACCTTGTAATAACGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019891
ERO1LB MISSION shRNA Bacterial Glycerol Stock
ERO1-like beta (S. cerevisiae)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019891.2-722s1c1
Sequence:CCGGGCTGCTCAGTATGTAGACCTACTCGAGTAGGTCTACATACTGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019891.2-1168s1c1
Sequence:CCGGGCGCTCAATTGTCGATCTTTACTCGAGTAAAGATCGACAATTGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019891.2-1262s1c1
Sequence:CCGGCCCATGCACTTTGATGAGAAACTCGAGTTTCTCATCAAAGTGCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019891.2-599s1c1
Sequence:CCGGGCTAATAAACTGGGAGCAATTCTCGAGAATTGCTCCCAGTTTATTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019891.2-1311s1c1
Sequence:CCGGCCAAGTCACTAAAGGAGGAATCTCGAGATTCCTCCTTTAGTGACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019891.3-809s21c1
Sequence:CCGGGAGCGTTACACTGGCTATAAACTCGAGTTTATAGCCAGTGTAACGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019891.3-1031s21c1
Sequence:CCGGTTACATCTATGCGCAAATTATCTCGAGATAATTTGCGCATAGATGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019891.3-1399s21c1
Sequence:CCGGCAAGAATATCTCCCGTATAATCTCGAGATTATACGGGAGATATTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019891
ERO1LB MISSION shRNA shRNA Plasmid DNA
ERO1-like beta (S. cerevisiae)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019891.2-722s1c1
Sequence:CCGGGCTGCTCAGTATGTAGACCTACTCGAGTAGGTCTACATACTGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019891.2-1168s1c1
Sequence:CCGGGCGCTCAATTGTCGATCTTTACTCGAGTAAAGATCGACAATTGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019891.2-1262s1c1
Sequence:CCGGCCCATGCACTTTGATGAGAAACTCGAGTTTCTCATCAAAGTGCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019891.2-599s1c1
Sequence:CCGGGCTAATAAACTGGGAGCAATTCTCGAGAATTGCTCCCAGTTTATTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019891.2-1311s1c1
Sequence:CCGGCCAAGTCACTAAAGGAGGAATCTCGAGATTCCTCCTTTAGTGACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019891.3-809s21c1
Sequence:CCGGGAGCGTTACACTGGCTATAAACTCGAGTTTATAGCCAGTGTAACGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019891.3-1031s21c1
Sequence:CCGGTTACATCTATGCGCAAATTATCTCGAGATAATTTGCGCATAGATGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019891.3-1399s21c1
Sequence:CCGGCAAGAATATCTCCCGTATAATCTCGAGATTATACGGGAGATATTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019891
ERO1LB MISSION shRNA Lentiviral Transduction Particles
ERO1-like beta (S. cerevisiae)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019891.2-722s1c1
Sequence:CCGGGCTGCTCAGTATGTAGACCTACTCGAGTAGGTCTACATACTGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019891.2-1168s1c1
Sequence:CCGGGCGCTCAATTGTCGATCTTTACTCGAGTAAAGATCGACAATTGAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019891.2-1262s1c1
Sequence:CCGGCCCATGCACTTTGATGAGAAACTCGAGTTTCTCATCAAAGTGCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019891.2-599s1c1
Sequence:CCGGGCTAATAAACTGGGAGCAATTCTCGAGAATTGCTCCCAGTTTATTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019891.2-1311s1c1
Sequence:CCGGCCAAGTCACTAAAGGAGGAATCTCGAGATTCCTCCTTTAGTGACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019891.3-809s21c1
Sequence:CCGGGAGCGTTACACTGGCTATAAACTCGAGTTTATAGCCAGTGTAACGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019891.3-1031s21c1
Sequence:CCGGTTACATCTATGCGCAAATTATCTCGAGATAATTTGCGCATAGATGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019891.3-1399s21c1
Sequence:CCGGCAAGAATATCTCCCGTATAATCTCGAGATTATACGGGAGATATTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)