EMAIL THIS PAGE TO A FRIEND

ESPL1

extra spindle pole bodies homolog 1 (S. cerevisiae)

58 Gene Product Result for
Synonyms: ESP1 SEPA
UniProtKB ID: Q14674
Gene ID:
Human(9700) Summary: Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]
Mouse(105988) extra spindle poles-like 1 (S. cerevisiae)
Rat(315330) extra spindle pole bodies homolog 1 (S. cerevisiae)
Zebrafish(797406) extra spindle poles like 1
dog(607879) extra spindle pole bodies homolog 1 (S. cerevisiae)
domestic cat(101084118) extra spindle pole bodies homolog 1 (S. cerevisiae)
cow(506740) extra spindle pole bodies homolog 1 (S. cerevisiae)
Horse(100063779) extra spindle pole bodies homolog 1 (S. cerevisiae)
chicken(425536) extra spindle pole bodies homolog 1 (S. cerevisiae)
sheep(101105898) extra spindle pole bodies homolog 1 (S. cerevisiae)
Domestic Rabbit(100356105) extra spindle pole bodies homolog 1 (S. cerevisiae)
naked mole-rat(101723260) extra spindle pole bodies homolog 1 (S. cerevisiae)
domestic guinea pig(100733255) extra spindle pole bodies homolog 1 (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503833 Anti-phospho-SEPARASE (pSer801) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1305624 ANTI-PHOSPHO-SEPARIN(S1126) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB4503690 Anti-SEPARASE antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
WH0009700M1 Monoclonal Anti-ESPL1 antibody produced in mouse clone 6H6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012291 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012291 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012291 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001014976 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001014976 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001014976 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012291 Rosetta Predictions human pricing
XM_001067790 Rosetta Predictions rat pricing
XM_235691 Rosetta Predictions rat pricing
NM_001014976 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124946 predicted 5746
2 SASI_Hs02_00344037 predicted 3822
3 SASI_Hs01_00124947 predicted 5973
4 SASI_Hs01_00124948 predicted 1148
5 SASI_Hs01_00124949 predicted 2887
6 SASI_Hs02_00344038 predicted 1569
7 SASI_Hs01_00124952 predicted 5720
8 SASI_Hs02_00344039 predicted 4262
9 SASI_Hs01_00124954 predicted 1373
10 SASI_Hs01_00124955 predicted 1290
11 SASI_Hs01_00124950 predicted 2973
12 SASI_Hs01_00124951 predicted 3121
13 SASI_Hs01_00124953 predicted 2176
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067790 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322315 predicted 5850
2 SASI_Rn02_00322316 predicted 2205
3 SASI_Rn02_00322317 predicted 3696
4 SASI_Rn02_00322318 predicted 3806
5 SASI_Rn02_00322319 predicted 5670
6 SASI_Rn02_00322320 predicted 2446
7 SASI_Rn02_00322321 predicted 4045
8 SASI_Rn02_00322322 predicted 3639
9 SASI_Rn02_00322323 predicted 5861
10 SASI_Rn02_00322324 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235691 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389586 predicted 5790
2 SASI_Rn02_00389587 predicted 2154
3 SASI_Rn02_00389588 predicted 3640
4 SASI_Rn02_00389589 predicted 3754
5 SASI_Rn02_00389590 predicted 5617
6 SASI_Rn02_00389591 predicted 2391
7 SASI_Rn02_00389592 predicted 3999
8 SASI_Rn02_00389593 predicted 3589
9 SASI_Rn02_00389594 predicted 5805
10 SASI_Rn02_00389595 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014976 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167410 predicted 5747
2 SASI_Mm01_00167411 predicted 2122
3 SASI_Mm01_00167412 predicted 2161
4 SASI_Mm01_00167413 predicted 1175
5 SASI_Mm01_00167414 predicted 6211
6 SASI_Mm02_00287450 predicted 5937
7 SASI_Mm01_00167415 predicted 790
8 SASI_Mm01_00167416 predicted 677
9 SASI_Mm01_00167417 predicted 2149
10 SASI_Mm01_00167418 predicted 5920
11 SASI_Mm01_00167419 predicted 1959
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012291
VALIDATED
ESPL1 MISSION shRNA Bacterial Glycerol Stock
extra spindle pole bodies homolog 1 (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_012291.4-6464s21c1
Sequence:CCGGGCTGTCTTATTGATGCTAGAACTCGAGTTCTAGCATCAATAAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012291.3-1367s1c1
Sequence:CCGGCCGCTTCTTACACCAGTAATTCTCGAGAATTACTGGTGTAAGAAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012291.4-1458s21c1
Sequence:CCGGCCGCTTCTTACACCAGTAATTCTCGAGAATTACTGGTGTAAGAAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_012291.3-2116s1c1
Sequence:CCGGCCTGGTAACTTGGAGGAATTTCTCGAGAAATTCCTCCAAGTTACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_012291.3-6373s1c1
Sequence:CCGGGCTGTCTTATTGATGCTAGAACTCGAGTTCTAGCATCAATAAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_012291.3-3842s1c1
Sequence:CCGGGCTGCTGTACTACCCAACTTTCTCGAGAAAGTTGGGTAGTACAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012291.4-2207s21c1
Sequence:CCGGCCTGGTAACTTGGAGGAATTTCTCGAGAAATTCCTCCAAGTTACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012291.4-3933s21c1
Sequence:CCGGGCTGCTGTACTACCCAACTTTCTCGAGAAAGTTGGGTAGTACAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_012291.3-2115s1c1
Sequence:CCGGCCCTGGTAACTTGGAGGAATTCTCGAGAATTCCTCCAAGTTACCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012291
VALIDATED
ESPL1 MISSION shRNA shRNA Plasmid DNA
extra spindle pole bodies homolog 1 (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_012291.4-6464s21c1
Sequence:CCGGGCTGTCTTATTGATGCTAGAACTCGAGTTCTAGCATCAATAAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012291.3-1367s1c1
Sequence:CCGGCCGCTTCTTACACCAGTAATTCTCGAGAATTACTGGTGTAAGAAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012291.4-1458s21c1
Sequence:CCGGCCGCTTCTTACACCAGTAATTCTCGAGAATTACTGGTGTAAGAAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_012291.3-2116s1c1
Sequence:CCGGCCTGGTAACTTGGAGGAATTTCTCGAGAAATTCCTCCAAGTTACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_012291.3-6373s1c1
Sequence:CCGGGCTGTCTTATTGATGCTAGAACTCGAGTTCTAGCATCAATAAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_012291.3-3842s1c1
Sequence:CCGGGCTGCTGTACTACCCAACTTTCTCGAGAAAGTTGGGTAGTACAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012291.4-2207s21c1
Sequence:CCGGCCTGGTAACTTGGAGGAATTTCTCGAGAAATTCCTCCAAGTTACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012291.4-3933s21c1
Sequence:CCGGGCTGCTGTACTACCCAACTTTCTCGAGAAAGTTGGGTAGTACAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_012291.3-2115s1c1
Sequence:CCGGCCCTGGTAACTTGGAGGAATTCTCGAGAATTCCTCCAAGTTACCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012291
VALIDATED
ESPL1 MISSION shRNA Lentiviral Transduction Particles
extra spindle pole bodies homolog 1 (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_012291.4-6464s21c1
Sequence:CCGGGCTGTCTTATTGATGCTAGAACTCGAGTTCTAGCATCAATAAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012291.3-1367s1c1
Sequence:CCGGCCGCTTCTTACACCAGTAATTCTCGAGAATTACTGGTGTAAGAAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012291.4-1458s21c1
Sequence:CCGGCCGCTTCTTACACCAGTAATTCTCGAGAATTACTGGTGTAAGAAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_012291.3-2116s1c1
Sequence:CCGGCCTGGTAACTTGGAGGAATTTCTCGAGAAATTCCTCCAAGTTACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_012291.3-6373s1c1
Sequence:CCGGGCTGTCTTATTGATGCTAGAACTCGAGTTCTAGCATCAATAAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_012291.3-3842s1c1
Sequence:CCGGGCTGCTGTACTACCCAACTTTCTCGAGAAAGTTGGGTAGTACAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012291.4-2207s21c1
Sequence:CCGGCCTGGTAACTTGGAGGAATTTCTCGAGAAATTCCTCCAAGTTACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012291.4-3933s21c1
Sequence:CCGGGCTGCTGTACTACCCAACTTTCTCGAGAAAGTTGGGTAGTACAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_012291.3-2115s1c1
Sequence:CCGGCCCTGGTAACTTGGAGGAATTCTCGAGAATTCCTCCAAGTTACCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001014976
VALIDATED
ESPL1 MISSION shRNA Bacterial Glycerol Stock
extra spindle pole bodies homolog 1 (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001014976.1-4159s21c1
Sequence:CCGGCGTGTCCCTTTCACCATATTTCTCGAGAAATATGGTGAAAGGGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001014976.1-1162s21c1
Sequence:CCGGTGTGGACTTGATGCCATATTGCTCGAGCAATATGGCATCAAGTCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001014976.1-302s21c1
Sequence:CCGGCTGGGCACCTGAGGAGTATTTCTCGAGAAATACTCCTCAGGTGCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001014976.1-6059s21c1
Sequence:CCGGCCCTGACAGAGCGGGATTTATCTCGAGATAAATCCCGCTCTGTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014976.1-3963s21c1
Sequence:CCGGCTGGCACCCACCATTAGTAAACTCGAGTTTACTAATGGTGGGTGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001014976
VALIDATED
ESPL1 MISSION shRNA shRNA Plasmid DNA
extra spindle pole bodies homolog 1 (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001014976.1-4159s21c1
Sequence:CCGGCGTGTCCCTTTCACCATATTTCTCGAGAAATATGGTGAAAGGGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001014976.1-1162s21c1
Sequence:CCGGTGTGGACTTGATGCCATATTGCTCGAGCAATATGGCATCAAGTCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001014976.1-302s21c1
Sequence:CCGGCTGGGCACCTGAGGAGTATTTCTCGAGAAATACTCCTCAGGTGCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001014976.1-6059s21c1
Sequence:CCGGCCCTGACAGAGCGGGATTTATCTCGAGATAAATCCCGCTCTGTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014976.1-3963s21c1
Sequence:CCGGCTGGCACCCACCATTAGTAAACTCGAGTTTACTAATGGTGGGTGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001014976
VALIDATED
ESPL1 MISSION shRNA Lentiviral Transduction Particles
extra spindle pole bodies homolog 1 (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001014976.1-4159s21c1
Sequence:CCGGCGTGTCCCTTTCACCATATTTCTCGAGAAATATGGTGAAAGGGACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001014976.1-1162s21c1
Sequence:CCGGTGTGGACTTGATGCCATATTGCTCGAGCAATATGGCATCAAGTCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001014976.1-302s21c1
Sequence:CCGGCTGGGCACCTGAGGAGTATTTCTCGAGAAATACTCCTCAGGTGCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001014976.1-6059s21c1
Sequence:CCGGCCCTGACAGAGCGGGATTTATCTCGAGATAAATCCCGCTCTGTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014976.1-3963s21c1
Sequence:CCGGCTGGCACCCACCATTAGTAAACTCGAGTTTACTAATGGTGGGTGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)