EMAIL THIS PAGE TO A FRIEND

ETFA

electron-transfer-flavoprotein, alpha polypeptide

78 Gene Product Result for
Synonyms: EMA GA2 MADD
UniProtKB ID: P13804, B4DT43, Q53XN3
Gene ID:
Human(2108) Summary: ETFA participates in catalyzing the initial step of the mitochondrial fatty acid beta-oxidation. It shuttles electrons between primary flavoprotein dehydrogenases and the membrane-bound electron transfer flavoprotein ubiquinone oxidoreductase. Defects in electron-transfer-flavoprotein have been implicated in type II glutaricaciduria in which multiple acyl-CoA dehydrogenase deficiencies result in large excretion of glutaric, lactic, ethylmalonic, butyric, isobutyric, 2-methyl-butyric, and isovaleric acids. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(110842) electron transferring flavoprotein, alpha polypeptide
Rat(300726) electron-transfer-flavoprotein, alpha polypeptide
Zebrafish(325724) electron-transfer-flavoprotein, alpha polypeptide
domestic cat(101095583) electron-transfer-flavoprotein, alpha polypeptide
cow(521892) electron-transfer-flavoprotein, alpha polypeptide
dog(610134) electron-transfer-flavoprotein, alpha polypeptide
chicken(415353) electron-transfer-flavoprotein, alpha polypeptide
domestic guinea pig(100722688) electron-transfer-flavoprotein, alpha polypeptide
naked mole-rat(101726646) electron-transfer-flavoprotein, alpha polypeptide
sheep(101102591) electron-transfer-flavoprotein, alpha polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV54290 Anti-ETFA (AB1) antibody produced in rabbit affinity isolated antibody rabbit, zebrafish, mouse, human, canine, pig, bovine, rat, guinea pig, horse
western blot pricing
AV54289 Anti-ETFA (AB2) antibody produced in rabbit affinity isolated antibody pig, horse, canine, bovine, human, rat, guinea pig, rabbit, mouse
western blot pricing
SAB2501356 Anti-ETFA (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, canine, bovine, human, canine, mouse
ELISA, western blot pricing
SAB2501355 Anti-ETFA antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, mouse, bovine, rat, human
ELISA, western blot pricing
SAB2701648 Anti-etfa antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
western blot pricing
HPA018990 Anti-ETFA antibody produced in rabbit Ab3, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
HPA018993 Anti-ETFA antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA018996 Anti-ETFA antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunohistochemistry, western blot pricing
HPA024089 Anti-ETFA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1402767 Monoclonal Anti-ETFA antibody produced in mouse clone 2A5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000126 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000126 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000126 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145615 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145615 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145615 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000126 Rosetta Predictions human pricing
NM_001127716 Rosetta Predictions human pricing
NM_001009668 Rosetta Predictions rat pricing
NM_145615 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216824 predicted 757
2 SASI_Hs01_00216825 predicted 253
3 SASI_Hs02_00301920 predicted 648
4 SASI_Hs02_00301921 predicted 336
5 SASI_Hs02_00301922 predicted 638
6 SASI_Hs02_00301923 predicted 523
7 SASI_Hs01_00216823 predicted 960
8 SASI_Hs02_00301924 predicted 485
9 SASI_Hs02_00301925 predicted 1019
10 SASI_Hs01_00216826 predicted 441
11 SASI_Hs01_00216827 predicted 371
12 SASI_Hs01_00216828 predicted 405
13 SASI_Hs01_00216829 predicted 506
14 SASI_Hs01_00216830 predicted 285
15 SASI_Hs01_00216831 predicted 661
16 SASI_Hs01_00216832 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330354 predicted 613
2 SASI_Hs02_00330355 predicted 499
3 SASI_Hs02_00330356 predicted 494
4 SASI_Hs02_00330357 predicted 384
5 SASI_Hs02_00330358 predicted 812
6 SASI_Hs02_00330359 predicted 340
7 SASI_Hs02_00330360 predicted 873
8 SASI_Hs02_00330361 predicted 288
9 SASI_Hs02_00330362 predicted 744
10 SASI_Hs02_00330363 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009668 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085567 predicted 854
2 SASI_Rn01_00085568 predicted 954
3 SASI_Rn01_00085569 predicted 235
4 SASI_Rn01_00085570 predicted 500
5 SASI_Rn01_00085571 predicted 480
6 SASI_Rn01_00085572 predicted 486
7 SASI_Rn02_00199702 predicted 538
8 SASI_Rn01_00085574 predicted 952
9 SASI_Rn01_00085575 predicted 852
10 SASI_Rn01_00085576 predicted 529
11 SASI_Rn01_00085573 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145615 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054348 predicted 870
2 SASI_Mm01_00054349 predicted 348
3 SASI_Mm01_00054350 predicted 956
4 SASI_Mm01_00054351 predicted 622
5 SASI_Mm02_00341191 predicted 590
6 SASI_Mm01_00054352 predicted 749
7 SASI_Mm01_00054353 predicted 578
8 SASI_Mm01_00054354 predicted 990
9 SASI_Mm01_00054356 predicted 849
10 SASI_Mm01_00054357 predicted 946
11 SASI_Mm01_00054355 predicted 584
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000126
VALIDATED
ETFA MISSION shRNA Bacterial Glycerol Stock
electron-transfer-flavoprotein, alpha polypeptide
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000126.3-350s21c1
Sequence:CCGGAGGAACTGACACCATTGATTTCTCGAGAAATCAATGGTGTCAGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000126.3-1138s21c1
Sequence:CCGGCAGATATTTGTGGGTATTATACTCGAGTATAATACCCACAAATATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000126.3-118s21c1
Sequence:CCGGGCGGCCTCATTGCTACGATTTCTCGAGAAATCGTAGCAATGAGGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000126.3-239s21c1
Sequence:CCGGGCTTAGTAGCTGGAACCAAATCTCGAGATTTGGTTCCAGCTACTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000126.3-678s21c1
Sequence:CCGGGCTTGACCAGAAATTAACAAACTCGAGTTTGTTAATTTCTGGTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000126.1-158s1c1
Sequence:CCGGGCTTAGTAGCTGGAACCAAATCTCGAGATTTGGTTCCAGCTACTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000126.1-814s1c1
Sequence:CCGGCCAGAACTTTATATTGCTGTTCTCGAGAACAGCAATATAAAGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000126.1-37s1c1
Sequence:CCGGGCGGCCTCATTGCTACGATTTCTCGAGAAATCGTAGCAATGAGGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000126.1-435s1c1
Sequence:CCGGGAGAACTATTTATGCAGGAAACTCGAGTTTCCTGCATAAATAGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000126.1-597s1c1
Sequence:CCGGGCTTGACCAGAAATTAACAAACTCGAGTTTGTTAATTTCTGGTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000126
VALIDATED
ETFA MISSION shRNA shRNA Plasmid DNA
electron-transfer-flavoprotein, alpha polypeptide
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000126.3-350s21c1
Sequence:CCGGAGGAACTGACACCATTGATTTCTCGAGAAATCAATGGTGTCAGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000126.3-1138s21c1
Sequence:CCGGCAGATATTTGTGGGTATTATACTCGAGTATAATACCCACAAATATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000126.3-118s21c1
Sequence:CCGGGCGGCCTCATTGCTACGATTTCTCGAGAAATCGTAGCAATGAGGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000126.3-239s21c1
Sequence:CCGGGCTTAGTAGCTGGAACCAAATCTCGAGATTTGGTTCCAGCTACTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000126.3-678s21c1
Sequence:CCGGGCTTGACCAGAAATTAACAAACTCGAGTTTGTTAATTTCTGGTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000126.1-158s1c1
Sequence:CCGGGCTTAGTAGCTGGAACCAAATCTCGAGATTTGGTTCCAGCTACTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000126.1-814s1c1
Sequence:CCGGCCAGAACTTTATATTGCTGTTCTCGAGAACAGCAATATAAAGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000126.1-37s1c1
Sequence:CCGGGCGGCCTCATTGCTACGATTTCTCGAGAAATCGTAGCAATGAGGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000126.1-435s1c1
Sequence:CCGGGAGAACTATTTATGCAGGAAACTCGAGTTTCCTGCATAAATAGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000126.1-597s1c1
Sequence:CCGGGCTTGACCAGAAATTAACAAACTCGAGTTTGTTAATTTCTGGTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000126
VALIDATED
ETFA MISSION shRNA Lentiviral Transduction Particles
electron-transfer-flavoprotein, alpha polypeptide
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000126.3-350s21c1
Sequence:CCGGAGGAACTGACACCATTGATTTCTCGAGAAATCAATGGTGTCAGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000126.3-1138s21c1
Sequence:CCGGCAGATATTTGTGGGTATTATACTCGAGTATAATACCCACAAATATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000126.3-118s21c1
Sequence:CCGGGCGGCCTCATTGCTACGATTTCTCGAGAAATCGTAGCAATGAGGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000126.3-239s21c1
Sequence:CCGGGCTTAGTAGCTGGAACCAAATCTCGAGATTTGGTTCCAGCTACTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000126.3-678s21c1
Sequence:CCGGGCTTGACCAGAAATTAACAAACTCGAGTTTGTTAATTTCTGGTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000126.1-158s1c1
Sequence:CCGGGCTTAGTAGCTGGAACCAAATCTCGAGATTTGGTTCCAGCTACTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000126.1-814s1c1
Sequence:CCGGCCAGAACTTTATATTGCTGTTCTCGAGAACAGCAATATAAAGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000126.1-37s1c1
Sequence:CCGGGCGGCCTCATTGCTACGATTTCTCGAGAAATCGTAGCAATGAGGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000126.1-435s1c1
Sequence:CCGGGAGAACTATTTATGCAGGAAACTCGAGTTTCCTGCATAAATAGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000126.1-597s1c1
Sequence:CCGGGCTTGACCAGAAATTAACAAACTCGAGTTTGTTAATTTCTGGTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145615
VALIDATED
ETFA MISSION shRNA Bacterial Glycerol Stock
electron-transfer-flavoprotein, alpha polypeptide
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145615.3-1053s1c1
Sequence:CCGGCAAGACAATCGTGGCTATTAACTCGAGTTAATAGCCACGATTGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145615.3-979s21c1
Sequence:CCGGATAGTAGCTCCAGAACTTTATCTCGAGATAAAGTTCTGGAGCTACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145615.3-1204s21c1
Sequence:CCGGTGAAAGTATTCAGCTGAAATCCTCGAGGATTTCAGCTGAATACTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145615.3-1053s21c1
Sequence:CCGGCAAGACAATCGTGGCTATTAACTCGAGTTAATAGCCACGATTGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145615.3-443s21c1
Sequence:CCGGAGGAACTCACACCATTGATTTCTCGAGAAATCAATGGTGTGAGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145615.3-602s21c1
Sequence:CCGGCATTTGTGAGAACTATCTATGCTCGAGCATAGATAGTTCTCACAAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145615.2-1067s1c1
Sequence:CCGGGCTATTAACAAAGATCCAGAACTCGAGTTCTGGATCTTTGTTAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145615.2-1124s1c1
Sequence:CCGGGCAGATTTATTTAAGGTGGTTCTCGAGAACCACCTTAAATAAATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145615
VALIDATED
ETFA MISSION shRNA shRNA Plasmid DNA
electron-transfer-flavoprotein, alpha polypeptide
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145615.3-1053s1c1
Sequence:CCGGCAAGACAATCGTGGCTATTAACTCGAGTTAATAGCCACGATTGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145615.3-979s21c1
Sequence:CCGGATAGTAGCTCCAGAACTTTATCTCGAGATAAAGTTCTGGAGCTACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145615.3-1204s21c1
Sequence:CCGGTGAAAGTATTCAGCTGAAATCCTCGAGGATTTCAGCTGAATACTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145615.3-1053s21c1
Sequence:CCGGCAAGACAATCGTGGCTATTAACTCGAGTTAATAGCCACGATTGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145615.3-443s21c1
Sequence:CCGGAGGAACTCACACCATTGATTTCTCGAGAAATCAATGGTGTGAGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145615.3-602s21c1
Sequence:CCGGCATTTGTGAGAACTATCTATGCTCGAGCATAGATAGTTCTCACAAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145615.2-1067s1c1
Sequence:CCGGGCTATTAACAAAGATCCAGAACTCGAGTTCTGGATCTTTGTTAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145615.2-1124s1c1
Sequence:CCGGGCAGATTTATTTAAGGTGGTTCTCGAGAACCACCTTAAATAAATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145615
VALIDATED
ETFA MISSION shRNA Lentiviral Transduction Particles
electron-transfer-flavoprotein, alpha polypeptide
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145615.3-1053s1c1
Sequence:CCGGCAAGACAATCGTGGCTATTAACTCGAGTTAATAGCCACGATTGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145615.3-979s21c1
Sequence:CCGGATAGTAGCTCCAGAACTTTATCTCGAGATAAAGTTCTGGAGCTACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145615.3-1204s21c1
Sequence:CCGGTGAAAGTATTCAGCTGAAATCCTCGAGGATTTCAGCTGAATACTTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145615.3-1053s21c1
Sequence:CCGGCAAGACAATCGTGGCTATTAACTCGAGTTAATAGCCACGATTGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145615.3-443s21c1
Sequence:CCGGAGGAACTCACACCATTGATTTCTCGAGAAATCAATGGTGTGAGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145615.3-602s21c1
Sequence:CCGGCATTTGTGAGAACTATCTATGCTCGAGCATAGATAGTTCTCACAAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145615.2-1067s1c1
Sequence:CCGGGCTATTAACAAAGATCCAGAACTCGAGTTCTGGATCTTTGTTAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145615.2-1124s1c1
Sequence:CCGGGCAGATTTATTTAAGGTGGTTCTCGAGAACCACCTTAAATAAATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)