EMAIL THIS PAGE TO A FRIEND

ETV4

ets variant 4

59 Gene Product Result for
Synonyms: E1A-F E1AF PEA3 PEAS3
UniProtKB ID: P43268, A8K314, B7Z5J3, B7Z9J6, Q96AW9
Gene ID:
Mouse(18612) ets variant gene 4 (E1A enhancer binding protein, E1AF)
Rat(360635) ets variant 4
Zebrafish(30700) ets variant gene 4
cow(281149) ets variant 4
cow(533129) ets variant 4
Horse(100065121) ets variant 4
domestic cat(101094892) ets variant 4
dog(403641) ets variant 4
chicken(395747) ets variant 4
sheep(101110344) ets variant 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001986 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001986 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001986 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008815 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008815 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008815 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079675 Rosetta Predictions human pricing
NM_001986 Rosetta Predictions human pricing
NM_001108299 Rosetta Predictions rat pricing
NM_008815 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313660 predicted 827
2 SASI_Hs02_00313661 predicted 626
3 SASI_Hs02_00313662 predicted 1950
4 SASI_Hs02_00313663 predicted 2007
5 SASI_Hs02_00313664 predicted 1286
6 SASI_Hs02_00313665 predicted 1080
7 SASI_Hs02_00313666 predicted 1620
8 SASI_Hs02_00313667 predicted 1062
9 SASI_Hs02_00313668 predicted 409
10 SASI_Hs02_00313669 predicted 1581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001986 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178905 predicted 689
2 SASI_Hs01_00178906 predicted 496
3 SASI_Hs01_00178907 predicted 1817
4 SASI_Hs01_00178908 predicted 1873
5 SASI_Hs01_00178909 predicted 1156
6 SASI_Hs01_00178910 predicted 953
7 SASI_Hs01_00178911 predicted 1489
8 SASI_Hs01_00178912 predicted 934
9 SASI_Hs01_00178913 predicted 281
10 SASI_Hs01_00178914 predicted 1454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108299 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237289 predicted 1770
2 SASI_Rn02_00237290 predicted 1189
3 SASI_Rn02_00237291 predicted 1094
4 SASI_Rn02_00237292 predicted 318
5 SASI_Rn02_00237293 predicted 1633
6 SASI_Rn02_00237294 predicted 1708
7 SASI_Rn02_00237295 predicted 1593
8 SASI_Rn02_00237296 predicted 274
9 SASI_Rn02_00237297 predicted 1071
10 SASI_Rn02_00237298 predicted 1581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008815 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132850 predicted 1174
2 SASI_Mm01_00132851 predicted 1741
3 SASI_Mm01_00132852 predicted 1309
4 SASI_Mm01_00132854 predicted 1129
5 SASI_Mm01_00132855 predicted 1346
6 SASI_Mm01_00132856 predicted 1620
7 SASI_Mm01_00132857 predicted 301
8 SASI_Mm01_00132858 predicted 1762
9 SASI_Mm01_00132859 predicted 1276
10 SASI_Mm02_00314750 predicted 1579
11 SASI_Mm01_00132853 predicted 717
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001986
VALIDATED
ETV4 MISSION shRNA Bacterial Glycerol Stock
ets variant 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001986.1-1564s1c1
Sequence:CCGGCCCTGTGTACATATAAATGAACTCGAGTTCATTTATATGTACACAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001986.1-736s1c1
Sequence:CCGGGCAGAGCTTTAAGCAAGAATACTCGAGTATTCTTGCTTAAAGCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001986.1-232s1c1
Sequence:CCGGCCAGGATCTAAGTCACTTCCACTCGAGTGGAAGTGACTTAGATCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001986.1-1129s1c1
Sequence:CCGGCCCAACAAATGCCCATTTCATCTCGAGATGAAATGGGCATTTGTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001986.1-1264s1c1
Sequence:CCGGGCTCCGATACTATTATGAGAACTCGAGTTCTCATAATAGTATCGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001986.2-1369s21c1
Sequence:CCGGAGCGTTACGTGTACAAGTTTGCTCGAGCAAACTTGTACACGTAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001986.2-290s21c1
Sequence:CCGGCCAGGATCTAAGTCACTTCCACTCGAGTGGAAGTGACTTAGATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001986.2-1225s21c1
Sequence:CCGGGAATGGAGTTCAAGCTCATTGCTCGAGCAATGAGCTTGAACTCCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001986.2-173s21c1
Sequence:CCGGCTACACCTTCAGCAGCAAATCCTCGAGGATTTGCTGCTGAAGGTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001986.2-1622s21c1
Sequence:CCGGCCCTGTGTACATATAAATGAACTCGAGTTCATTTATATGTACACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001986
VALIDATED
ETV4 MISSION shRNA shRNA Plasmid DNA
ets variant 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001986.1-1564s1c1
Sequence:CCGGCCCTGTGTACATATAAATGAACTCGAGTTCATTTATATGTACACAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001986.1-736s1c1
Sequence:CCGGGCAGAGCTTTAAGCAAGAATACTCGAGTATTCTTGCTTAAAGCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001986.1-232s1c1
Sequence:CCGGCCAGGATCTAAGTCACTTCCACTCGAGTGGAAGTGACTTAGATCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001986.1-1129s1c1
Sequence:CCGGCCCAACAAATGCCCATTTCATCTCGAGATGAAATGGGCATTTGTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001986.1-1264s1c1
Sequence:CCGGGCTCCGATACTATTATGAGAACTCGAGTTCTCATAATAGTATCGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001986.2-1369s21c1
Sequence:CCGGAGCGTTACGTGTACAAGTTTGCTCGAGCAAACTTGTACACGTAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001986.2-290s21c1
Sequence:CCGGCCAGGATCTAAGTCACTTCCACTCGAGTGGAAGTGACTTAGATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001986.2-1225s21c1
Sequence:CCGGGAATGGAGTTCAAGCTCATTGCTCGAGCAATGAGCTTGAACTCCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001986.2-173s21c1
Sequence:CCGGCTACACCTTCAGCAGCAAATCCTCGAGGATTTGCTGCTGAAGGTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001986.2-1622s21c1
Sequence:CCGGCCCTGTGTACATATAAATGAACTCGAGTTCATTTATATGTACACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001986
VALIDATED
ETV4 MISSION shRNA Lentiviral Transduction Particles
ets variant 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001986.1-1564s1c1
Sequence:CCGGCCCTGTGTACATATAAATGAACTCGAGTTCATTTATATGTACACAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001986.1-736s1c1
Sequence:CCGGGCAGAGCTTTAAGCAAGAATACTCGAGTATTCTTGCTTAAAGCTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001986.1-232s1c1
Sequence:CCGGCCAGGATCTAAGTCACTTCCACTCGAGTGGAAGTGACTTAGATCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001986.1-1129s1c1
Sequence:CCGGCCCAACAAATGCCCATTTCATCTCGAGATGAAATGGGCATTTGTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001986.1-1264s1c1
Sequence:CCGGGCTCCGATACTATTATGAGAACTCGAGTTCTCATAATAGTATCGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001986.2-1369s21c1
Sequence:CCGGAGCGTTACGTGTACAAGTTTGCTCGAGCAAACTTGTACACGTAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001986.2-290s21c1
Sequence:CCGGCCAGGATCTAAGTCACTTCCACTCGAGTGGAAGTGACTTAGATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001986.2-1225s21c1
Sequence:CCGGGAATGGAGTTCAAGCTCATTGCTCGAGCAATGAGCTTGAACTCCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001986.2-173s21c1
Sequence:CCGGCTACACCTTCAGCAGCAAATCCTCGAGGATTTGCTGCTGAAGGTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001986.2-1622s21c1
Sequence:CCGGCCCTGTGTACATATAAATGAACTCGAGTTCATTTATATGTACACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008815
VALIDATED
ETV4 MISSION shRNA Bacterial Glycerol Stock
ets variant 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008815.1-1532s1c1
Sequence:CCGGGCTGCGATACTATTATGAGAACTCGAGTTCTCATAATAGTATCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008815.1-1397s1c1
Sequence:CCGGCCCAACAAATGCTCATTTCATCTCGAGATGAAATGAGCATTTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008815.1-1218s1c1
Sequence:CCGGGTGATGGGTTATGGCTATGAACTCGAGTTCATAGCCATAACCCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008815.1-1635s1c1
Sequence:CCGGCCAGATAATCAACGTCCAGCTCTCGAGAGCTGGACGTTGATTATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008815.1-356s1c1
Sequence:CCGGGCGGAGGATGAAAGGCGGATACTCGAGTATCCGCCTTTCATCCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008815.2-1137s21c1
Sequence:CCGGGTGATGGGTTATGGCTATGAACTCGAGTTCATAGCCATAACCCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008815.2-1684s21c1
Sequence:CCGGTCGGCCACAGAGGTGGATATTCTCGAGAATATCCACCTCTGTGGCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008815.2-310s21c1
Sequence:CCGGGCAGCAAATCTCCCGGAAATGCTCGAGCATTTCCGGGAGATTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008815.2-1071s21c1
Sequence:CCGGGTCCCTGGATGTGCATCAATGCTCGAGCATTGATGCACATCCAGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008815.2-1890s21c1
Sequence:CCGGTGGAGGCAGGCCAAATCTAAACTCGAGTTTAGATTTGGCCTGCCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008815
VALIDATED
ETV4 MISSION shRNA shRNA Plasmid DNA
ets variant 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008815.1-1532s1c1
Sequence:CCGGGCTGCGATACTATTATGAGAACTCGAGTTCTCATAATAGTATCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008815.1-1397s1c1
Sequence:CCGGCCCAACAAATGCTCATTTCATCTCGAGATGAAATGAGCATTTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008815.1-1218s1c1
Sequence:CCGGGTGATGGGTTATGGCTATGAACTCGAGTTCATAGCCATAACCCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008815.1-1635s1c1
Sequence:CCGGCCAGATAATCAACGTCCAGCTCTCGAGAGCTGGACGTTGATTATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008815.1-356s1c1
Sequence:CCGGGCGGAGGATGAAAGGCGGATACTCGAGTATCCGCCTTTCATCCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008815.2-1137s21c1
Sequence:CCGGGTGATGGGTTATGGCTATGAACTCGAGTTCATAGCCATAACCCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008815.2-1684s21c1
Sequence:CCGGTCGGCCACAGAGGTGGATATTCTCGAGAATATCCACCTCTGTGGCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008815.2-310s21c1
Sequence:CCGGGCAGCAAATCTCCCGGAAATGCTCGAGCATTTCCGGGAGATTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008815.2-1071s21c1
Sequence:CCGGGTCCCTGGATGTGCATCAATGCTCGAGCATTGATGCACATCCAGGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008815.2-1890s21c1
Sequence:CCGGTGGAGGCAGGCCAAATCTAAACTCGAGTTTAGATTTGGCCTGCCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008815
VALIDATED
ETV4 MISSION shRNA Lentiviral Transduction Particles
ets variant 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008815.1-1532s1c1
Sequence:CCGGGCTGCGATACTATTATGAGAACTCGAGTTCTCATAATAGTATCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008815.1-1397s1c1
Sequence:CCGGCCCAACAAATGCTCATTTCATCTCGAGATGAAATGAGCATTTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008815.1-1218s1c1
Sequence:CCGGGTGATGGGTTATGGCTATGAACTCGAGTTCATAGCCATAACCCATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008815.1-1635s1c1
Sequence:CCGGCCAGATAATCAACGTCCAGCTCTCGAGAGCTGGACGTTGATTATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008815.1-356s1c1
Sequence:CCGGGCGGAGGATGAAAGGCGGATACTCGAGTATCCGCCTTTCATCCTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008815.2-1137s21c1
Sequence:CCGGGTGATGGGTTATGGCTATGAACTCGAGTTCATAGCCATAACCCATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008815.2-1684s21c1
Sequence:CCGGTCGGCCACAGAGGTGGATATTCTCGAGAATATCCACCTCTGTGGCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008815.2-310s21c1
Sequence:CCGGGCAGCAAATCTCCCGGAAATGCTCGAGCATTTCCGGGAGATTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008815.2-1071s21c1
Sequence:CCGGGTCCCTGGATGTGCATCAATGCTCGAGCATTGATGCACATCCAGGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008815.2-1890s21c1
Sequence:CCGGTGGAGGCAGGCCAAATCTAAACTCGAGTTTAGATTTGGCCTGCCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)