EMAIL THIS PAGE TO A FRIEND

EXOC6

exocyst complex component 6

86 Gene Product Result for
Synonyms: EXOC6A SEC15 SEC15L SEC15L1 SEC15L3 Sec15p
UniProtKB ID: Q8TAG9, E9PHI3, Q5VXH8, Q9NZ24
Gene ID:
Human(54536) Summary: The product of this gene belongs to the SEC15 family. It is highly similar to the protein encoded by Saccharomyces cerevisiae SEC15 gene. This protein is essential for vesicular traffic from the Golgi apparatus to the cell surface in yeast. It is one of the components of a multiprotein complex required for exocytosis. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(107371) exocyst complex component 6
Rat(50556) exocyst complex component 6
Zebrafish(406591) exocyst complex component 6
cow(507518) exocyst complex component 6
Horse(100061840) exocyst complex component 6
domestic cat(101086179) exocyst complex component 6
dog(477771) exocyst complex component 6
chicken(423807) exocyst complex component 6
domestic guinea pig(100719927) exocyst complex component 6
naked mole-rat(101708012) exocyst complex component 6
sheep(101103200) exocyst complex component 6
Domestic Rabbit(100342397) exocyst complex component 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019053 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019053 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019053 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175353 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175353 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175353 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013848 Rosetta Predictions human pricing
NM_019053 Rosetta Predictions human pricing
NM_019277 Rosetta Predictions rat pricing
NM_175353 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306511 predicted 2075
2 SASI_Hs01_00061632 predicted 506
3 SASI_Hs02_00306512 predicted 1877
4 SASI_Hs02_00306513 predicted 1662
5 SASI_Hs01_00061634 predicted 459
6 SASI_Hs01_00061638 predicted 1155
7 SASI_Hs01_00061639 predicted 2402
8 SASI_Hs01_00061640 predicted 936
9 SASI_Hs02_00306514 predicted 2261
10 SASI_Hs02_00306515 predicted 338
11 SASI_Hs01_00061631 predicted 1107
12 SASI_Hs01_00061633 predicted 1905
13 SASI_Hs01_00061635 predicted 2352
14 SASI_Hs01_00061636 predicted 984
15 SASI_Hs01_00061637 predicted 2469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019053 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352627 predicted 2112
2 SASI_Hs01_00238076 predicted 538
3 SASI_Hs02_00352628 predicted 1916
4 SASI_Hs02_00352629 predicted 1701
5 SASI_Hs01_00238078 predicted 498
6 SASI_Hs01_00238082 predicted 1197
7 SASI_Hs01_00238083 predicted 2435
8 SASI_Hs01_00238084 predicted 973
9 SASI_Hs02_00352630 predicted 2301
10 SASI_Hs02_00352631 predicted 377
11 SASI_Hs01_00238075 predicted 1138
12 SASI_Hs01_00238077 predicted 1941
13 SASI_Hs01_00238079 predicted 2391
14 SASI_Hs01_00238080 predicted 1028
15 SASI_Hs01_00238081 predicted 2505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019277 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262200 predicted 402
2 SASI_Rn01_00089187 predicted 1633
3 SASI_Rn01_00089189 predicted 1367
4 SASI_Rn02_00262201 predicted 2119
5 SASI_Rn01_00089190 predicted 2095
6 SASI_Rn01_00089191 predicted 2427
7 SASI_Rn01_00089192 predicted 844
8 SASI_Rn01_00089193 predicted 685
9 SASI_Rn01_00089194 predicted 2229
10 SASI_Rn02_00262202 predicted 507
11 SASI_Rn01_00089188 predicted 1974
12 SASI_Rn01_00089195 predicted 1682
13 SASI_Rn01_00089196 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175353 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112623 predicted 503
2 SASI_Mm01_00112625 predicted 1325
3 SASI_Mm01_00112626 predicted 1500
4 SASI_Mm01_00112627 predicted 1383
5 SASI_Mm01_00112628 predicted 2238
6 SASI_Mm01_00112629 predicted 1265
7 SASI_Mm01_00112630 predicted 1295
8 SASI_Mm01_00112631 predicted 270
9 SASI_Mm02_00346151 predicted 2108
10 SASI_Mm02_00346152 predicted 1735
11 SASI_Mm01_00112622 predicted 414
12 SASI_Mm01_00112624 predicted 1032
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019053
VALIDATED
EXOC6 MISSION shRNA Bacterial Glycerol Stock
exocyst complex component 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019053.4-217s21c1
Sequence:CCGCTTAGATGCTTGTATCCGTAATCTCGAGATTACGGATACAAGCATCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019053.4-1956s21c1
Sequence:CCGGTGGTTATTTAATGGACCTTATCTCGAGATAAGGTCCATTAAATAACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019053.4-623s21c1
Sequence:CCGGCCAAACTCCGTGAGGATATTACTCGAGTAATATCCTCACGGAGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_019053.2-2086s1c1
Sequence:CCGGGCAGTTTAACTTAGATGTCATCTCGAGATGACATCTAAGTTAAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_019053.2-674s1c1
Sequence:CCGGGCAATGAAACAGGCACAGCATCTCGAGATGCTGTGCCTGTTTCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_019053.2-1548s1c1
Sequence:CCGGGCTCAACAGAAATAGACGATACTCGAGTATCGTCTATTTCTGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_019053.2-981s1c1
Sequence:CCGGCCCAGTCGAATATGCATGAAACTCGAGTTTCATGCATATTCGACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_019053.2-1412s1c1
Sequence:CCGGCCCTTTCAAGATCCAGACCTTCTCGAGAAGGTCTGGATCTTGAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019053
VALIDATED
EXOC6 MISSION shRNA shRNA Plasmid DNA
exocyst complex component 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019053.4-217s21c1
Sequence:CCGCTTAGATGCTTGTATCCGTAATCTCGAGATTACGGATACAAGCATCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019053.4-1956s21c1
Sequence:CCGGTGGTTATTTAATGGACCTTATCTCGAGATAAGGTCCATTAAATAACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019053.4-623s21c1
Sequence:CCGGCCAAACTCCGTGAGGATATTACTCGAGTAATATCCTCACGGAGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_019053.2-2086s1c1
Sequence:CCGGGCAGTTTAACTTAGATGTCATCTCGAGATGACATCTAAGTTAAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_019053.2-674s1c1
Sequence:CCGGGCAATGAAACAGGCACAGCATCTCGAGATGCTGTGCCTGTTTCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_019053.2-1548s1c1
Sequence:CCGGGCTCAACAGAAATAGACGATACTCGAGTATCGTCTATTTCTGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_019053.2-981s1c1
Sequence:CCGGCCCAGTCGAATATGCATGAAACTCGAGTTTCATGCATATTCGACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_019053.2-1412s1c1
Sequence:CCGGCCCTTTCAAGATCCAGACCTTCTCGAGAAGGTCTGGATCTTGAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019053
VALIDATED
EXOC6 MISSION shRNA Lentiviral Transduction Particles
exocyst complex component 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019053.4-217s21c1
Sequence:CCGCTTAGATGCTTGTATCCGTAATCTCGAGATTACGGATACAAGCATCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019053.4-1956s21c1
Sequence:CCGGTGGTTATTTAATGGACCTTATCTCGAGATAAGGTCCATTAAATAACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019053.4-623s21c1
Sequence:CCGGCCAAACTCCGTGAGGATATTACTCGAGTAATATCCTCACGGAGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_019053.2-2086s1c1
Sequence:CCGGGCAGTTTAACTTAGATGTCATCTCGAGATGACATCTAAGTTAAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_019053.2-674s1c1
Sequence:CCGGGCAATGAAACAGGCACAGCATCTCGAGATGCTGTGCCTGTTTCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_019053.2-1548s1c1
Sequence:CCGGGCTCAACAGAAATAGACGATACTCGAGTATCGTCTATTTCTGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_019053.2-981s1c1
Sequence:CCGGCCCAGTCGAATATGCATGAAACTCGAGTTTCATGCATATTCGACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_019053.2-1412s1c1
Sequence:CCGGCCCTTTCAAGATCCAGACCTTCTCGAGAAGGTCTGGATCTTGAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175353
VALIDATED
EXOC6 MISSION shRNA Bacterial Glycerol Stock
exocyst complex component 6
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175353.2-1685s21c1
Sequence:CCGGGCTGGTGCAAATTATCATAAACTCGAGTTTATGATAATTTGCACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175353.2-853s21c1
Sequence:CCGGAGAACGACGAGGAGGTCTTAACTCGAGTTAAGACCTCCTCGTCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175353.2-1222s21c1
Sequence:CCGGTGAAGAATCTCATCGTAATTTCTCGAGAAATTACGATGAGATTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175353.2-1882s21c1
Sequence:CCGGTTGTTCAGCTGGCTGATTATGCTCGAGCATAATCAGCCAGCTGAACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175353.2-875s21c1
Sequence:CCGGTGTTCAAGATCTCGTTGATTTCTCGAGAAATCAACGAGATCTTGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175353.2-1639s21c1
Sequence:CCGGGCTGTTTACTGAACCTTATTACTCGAGTAATAAGGTTCAGTAAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175353.2-2505s1c1
Sequence:CCGGCGTGAGACAATAACTTGTTTACTCGAGTAAACAAGTTATTGTCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175353.2-1789s1c1
Sequence:CCGGCCACAAGACTTTATGGACTTTCTCGAGAAAGTCCATAAAGTCTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175353.2-779s1c1
Sequence:CCGGGCATGTAAATAATGACAGGATCTCGAGATCCTGTCATTATTTACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175353.2-174s1c1
Sequence:CCGGGCACACAAGAAGTTTATGGAACTCGAGTTCCATAAACTTCTTGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175353.2-1685s1c1
Sequence:CCGGGCTGGTGCAAATTATCATAAACTCGAGTTTATGATAATTTGCACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175353
VALIDATED
EXOC6 MISSION shRNA shRNA Plasmid DNA
exocyst complex component 6
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175353.2-1685s21c1
Sequence:CCGGGCTGGTGCAAATTATCATAAACTCGAGTTTATGATAATTTGCACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175353.2-853s21c1
Sequence:CCGGAGAACGACGAGGAGGTCTTAACTCGAGTTAAGACCTCCTCGTCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175353.2-1222s21c1
Sequence:CCGGTGAAGAATCTCATCGTAATTTCTCGAGAAATTACGATGAGATTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175353.2-1882s21c1
Sequence:CCGGTTGTTCAGCTGGCTGATTATGCTCGAGCATAATCAGCCAGCTGAACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175353.2-875s21c1
Sequence:CCGGTGTTCAAGATCTCGTTGATTTCTCGAGAAATCAACGAGATCTTGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175353.2-1639s21c1
Sequence:CCGGGCTGTTTACTGAACCTTATTACTCGAGTAATAAGGTTCAGTAAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175353.2-2505s1c1
Sequence:CCGGCGTGAGACAATAACTTGTTTACTCGAGTAAACAAGTTATTGTCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175353.2-1789s1c1
Sequence:CCGGCCACAAGACTTTATGGACTTTCTCGAGAAAGTCCATAAAGTCTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175353.2-779s1c1
Sequence:CCGGGCATGTAAATAATGACAGGATCTCGAGATCCTGTCATTATTTACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175353.2-174s1c1
Sequence:CCGGGCACACAAGAAGTTTATGGAACTCGAGTTCCATAAACTTCTTGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175353.2-1685s1c1
Sequence:CCGGGCTGGTGCAAATTATCATAAACTCGAGTTTATGATAATTTGCACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175353
VALIDATED
EXOC6 MISSION shRNA Lentiviral Transduction Particles
exocyst complex component 6
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175353.2-1685s21c1
Sequence:CCGGGCTGGTGCAAATTATCATAAACTCGAGTTTATGATAATTTGCACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175353.2-853s21c1
Sequence:CCGGAGAACGACGAGGAGGTCTTAACTCGAGTTAAGACCTCCTCGTCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175353.2-1222s21c1
Sequence:CCGGTGAAGAATCTCATCGTAATTTCTCGAGAAATTACGATGAGATTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175353.2-1882s21c1
Sequence:CCGGTTGTTCAGCTGGCTGATTATGCTCGAGCATAATCAGCCAGCTGAACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175353.2-875s21c1
Sequence:CCGGTGTTCAAGATCTCGTTGATTTCTCGAGAAATCAACGAGATCTTGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175353.2-1639s21c1
Sequence:CCGGGCTGTTTACTGAACCTTATTACTCGAGTAATAAGGTTCAGTAAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175353.2-2505s1c1
Sequence:CCGGCGTGAGACAATAACTTGTTTACTCGAGTAAACAAGTTATTGTCTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175353.2-1789s1c1
Sequence:CCGGCCACAAGACTTTATGGACTTTCTCGAGAAAGTCCATAAAGTCTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175353.2-779s1c1
Sequence:CCGGGCATGTAAATAATGACAGGATCTCGAGATCCTGTCATTATTTACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175353.2-174s1c1
Sequence:CCGGGCACACAAGAAGTTTATGGAACTCGAGTTCCATAAACTTCTTGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175353.2-1685s1c1
Sequence:CCGGGCTGGTGCAAATTATCATAAACTCGAGTTTATGATAATTTGCACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)