EMAIL THIS PAGE TO A FRIEND

EXOC8

exocyst complex component 8

139 Gene Product Result for
Synonyms: EXO84 Exo84p SEC84
UniProtKB ID: Q8IYI6, B3KU33, Q5TE82
Gene ID:
Mouse(102058) exocyst complex component 8
Rat(245709) exocyst complex component 8
Zebrafish(568029) exocyst complex component 8
cow(540237) exocyst complex component 8
Horse(100051172) exocyst complex component 8
domestic cat(101088434) exocyst complex component 8
dog(488973) exocyst complex component 8
chicken(421531) exocyst complex component 8
sheep(101113907) exocyst complex component 8
naked mole-rat(101711332) exocyst complex component 8
domestic guinea pig(100729665) exocyst complex component 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA027438 Anti-EXOC8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2105900 Anti-EXOC8, (N-terminal) antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, horse, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198103 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198103 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198103 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175876 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175876 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175876 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175876 Rosetta Predictions human pricing
NM_139043 Rosetta Predictions rat pricing
NM_198103 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215827 predicted 819
2 SASI_Hs01_00215828 predicted 1497
3 SASI_Hs01_00215829 predicted 779
4 SASI_Hs01_00215830 predicted 1762
5 SASI_Hs01_00215831 predicted 2056
6 SASI_Hs01_00215832 predicted 2045
7 SASI_Hs01_00215833 predicted 992
8 SASI_Hs01_00215834 predicted 770
9 SASI_Hs01_00215835 predicted 1942
10 SASI_Hs01_00215836 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139043 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059865 predicted 902
2 SASI_Rn02_00268422 predicted 661
3 SASI_Rn01_00059866 predicted 688
4 SASI_Rn01_00059867 predicted 888
5 SASI_Rn01_00059868 predicted 1725
6 SASI_Rn01_00059869 predicted 862
7 SASI_Rn01_00059870 predicted 693
8 SASI_Rn02_00268423 predicted 863
9 SASI_Rn01_00059872 predicted 1543
10 SASI_Rn01_00059873 predicted 1839
11 SASI_Rn01_00059871 predicted 1802
12 SASI_Rn01_00059874 predicted 1924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198103 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140587 predicted 228
2 SASI_Mm02_00350825 predicted 1543
3 SASI_Mm01_00140588 predicted 587
4 SASI_Mm01_00140589 predicted 821
5 SASI_Mm01_00140590 predicted 1717
6 SASI_Mm02_00350826 predicted 1728
7 SASI_Mm01_00140594 predicted 1765
8 SASI_Mm01_00140595 predicted 716
9 SASI_Mm01_00140596 predicted 1464
10 SASI_Mm02_00350827 predicted 1477
11 SASI_Mm01_00140591 predicted 785
12 SASI_Mm01_00140592 predicted 1650
13 SASI_Mm01_00140593 predicted 1086
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198103
VALIDATED
EXOC8 MISSION shRNA Bacterial Glycerol Stock
exocyst complex component 8
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198103.1-301s1c1
Sequence:CCGGCTACCTGGAGAGCGAAATGTACTCGAGTACATTTCGCTCTCCAGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198103.1-4420s1c1
Sequence:CCGGGCCAAACAAATGTACTCATTTCTCGAGAAATGAGTACATTTGTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198103.1-2077s1c1
Sequence:CCGGGCAGAACGCATCCTTTCTCTACTCGAGTAGAGAAAGGATGCGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198103.1-1129s1c1
Sequence:CCGGGCTGGACAAATTAAATCACTACTCGAGTAGTGATTTAATTTGTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198103.2-1467s21c1
Sequence:CCGGGAGAGTTTGAGACGGACTTTGCTCGAGCAAAGTCCGTCTCAAACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198103.2-2077s21c1
Sequence:CCGGGCAGAACGCATCCTTTCTCTACTCGAGTAGAGAAAGGATGCGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198103.2-2321s21c1
Sequence:CCGGAGAGACACAGACAGCATATAACTCGAGTTATATGCTGTCTGTGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198103.2-1129s21c1
Sequence:CCGGGCTGGACAAATTAAATCACTACTCGAGTAGTGATTTAATTTGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198103.2-301s21c1
Sequence:CCGGCTACCTGGAGAGCGAAATGTACTCGAGTACATTTCGCTCTCCAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198103
VALIDATED
EXOC8 MISSION shRNA shRNA Plasmid DNA
exocyst complex component 8
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198103.1-301s1c1
Sequence:CCGGCTACCTGGAGAGCGAAATGTACTCGAGTACATTTCGCTCTCCAGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198103.1-4420s1c1
Sequence:CCGGGCCAAACAAATGTACTCATTTCTCGAGAAATGAGTACATTTGTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198103.1-2077s1c1
Sequence:CCGGGCAGAACGCATCCTTTCTCTACTCGAGTAGAGAAAGGATGCGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198103.1-1129s1c1
Sequence:CCGGGCTGGACAAATTAAATCACTACTCGAGTAGTGATTTAATTTGTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198103.2-1467s21c1
Sequence:CCGGGAGAGTTTGAGACGGACTTTGCTCGAGCAAAGTCCGTCTCAAACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198103.2-2077s21c1
Sequence:CCGGGCAGAACGCATCCTTTCTCTACTCGAGTAGAGAAAGGATGCGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198103.2-2321s21c1
Sequence:CCGGAGAGACACAGACAGCATATAACTCGAGTTATATGCTGTCTGTGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198103.2-1129s21c1
Sequence:CCGGGCTGGACAAATTAAATCACTACTCGAGTAGTGATTTAATTTGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198103.2-301s21c1
Sequence:CCGGCTACCTGGAGAGCGAAATGTACTCGAGTACATTTCGCTCTCCAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198103
VALIDATED
EXOC8 MISSION shRNA Lentiviral Transduction Particles
exocyst complex component 8
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198103.1-301s1c1
Sequence:CCGGCTACCTGGAGAGCGAAATGTACTCGAGTACATTTCGCTCTCCAGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198103.1-4420s1c1
Sequence:CCGGGCCAAACAAATGTACTCATTTCTCGAGAAATGAGTACATTTGTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198103.1-2077s1c1
Sequence:CCGGGCAGAACGCATCCTTTCTCTACTCGAGTAGAGAAAGGATGCGTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198103.1-1129s1c1
Sequence:CCGGGCTGGACAAATTAAATCACTACTCGAGTAGTGATTTAATTTGTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198103.2-1467s21c1
Sequence:CCGGGAGAGTTTGAGACGGACTTTGCTCGAGCAAAGTCCGTCTCAAACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198103.2-2077s21c1
Sequence:CCGGGCAGAACGCATCCTTTCTCTACTCGAGTAGAGAAAGGATGCGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198103.2-2321s21c1
Sequence:CCGGAGAGACACAGACAGCATATAACTCGAGTTATATGCTGTCTGTGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198103.2-1129s21c1
Sequence:CCGGGCTGGACAAATTAAATCACTACTCGAGTAGTGATTTAATTTGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198103.2-301s21c1
Sequence:CCGGCTACCTGGAGAGCGAAATGTACTCGAGTACATTTCGCTCTCCAGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175876
EXOC8 MISSION shRNA Bacterial Glycerol Stock
exocyst complex component 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175876.2-1727s1c1
Sequence:CCGGGCACAGTTACAAAGAAATCATCTCGAGATGATTTCTTTGTAACTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175876.2-1139s1c1
Sequence:CCGGGCTGGATAAATTGAACCATTACTCGAGTAATGGTTCAATTTATCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175876.2-1371s1c1
Sequence:CCGGGCCGCTGTTCATACTGCAATTCTCGAGAATTGCAGTATGAACAGCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175876.2-2022s1c1
Sequence:CCGGGCTGTTCAGCATGTGGATTATCTCGAGATAATCCACATGCTGAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175876.3-2334s21c1
Sequence:CCGGGTTGTATTAGCATACTCTATACTCGAGTATAGAGTATGCTAATACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175876.3-1360s21c1
Sequence:CCGGACGAAGGCCTGTGAGCTATTTCTCGAGAAATAGCTCACAGGCCTTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175876.3-2293s21c1
Sequence:CCGGATGCAGAGAGAGAGCTTATATCTCGAGATATAAGCTCTCTCTCTGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175876.3-761s21c1
Sequence:CCGGATCGCTACAACGCTCTCTATTCTCGAGAATAGAGAGCGTTGTAGCGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175876
EXOC8 MISSION shRNA shRNA Plasmid DNA
exocyst complex component 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175876.2-1727s1c1
Sequence:CCGGGCACAGTTACAAAGAAATCATCTCGAGATGATTTCTTTGTAACTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175876.2-1139s1c1
Sequence:CCGGGCTGGATAAATTGAACCATTACTCGAGTAATGGTTCAATTTATCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175876.2-1371s1c1
Sequence:CCGGGCCGCTGTTCATACTGCAATTCTCGAGAATTGCAGTATGAACAGCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175876.2-2022s1c1
Sequence:CCGGGCTGTTCAGCATGTGGATTATCTCGAGATAATCCACATGCTGAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175876.3-2334s21c1
Sequence:CCGGGTTGTATTAGCATACTCTATACTCGAGTATAGAGTATGCTAATACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175876.3-1360s21c1
Sequence:CCGGACGAAGGCCTGTGAGCTATTTCTCGAGAAATAGCTCACAGGCCTTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175876.3-2293s21c1
Sequence:CCGGATGCAGAGAGAGAGCTTATATCTCGAGATATAAGCTCTCTCTCTGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175876.3-761s21c1
Sequence:CCGGATCGCTACAACGCTCTCTATTCTCGAGAATAGAGAGCGTTGTAGCGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175876
EXOC8 MISSION shRNA Lentiviral Transduction Particles
exocyst complex component 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175876.2-1727s1c1
Sequence:CCGGGCACAGTTACAAAGAAATCATCTCGAGATGATTTCTTTGTAACTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175876.2-1139s1c1
Sequence:CCGGGCTGGATAAATTGAACCATTACTCGAGTAATGGTTCAATTTATCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175876.2-1371s1c1
Sequence:CCGGGCCGCTGTTCATACTGCAATTCTCGAGAATTGCAGTATGAACAGCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175876.2-2022s1c1
Sequence:CCGGGCTGTTCAGCATGTGGATTATCTCGAGATAATCCACATGCTGAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175876.3-2334s21c1
Sequence:CCGGGTTGTATTAGCATACTCTATACTCGAGTATAGAGTATGCTAATACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175876.3-1360s21c1
Sequence:CCGGACGAAGGCCTGTGAGCTATTTCTCGAGAAATAGCTCACAGGCCTTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175876.3-2293s21c1
Sequence:CCGGATGCAGAGAGAGAGCTTATATCTCGAGATATAAGCTCTCTCTCTGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175876.3-761s21c1
Sequence:CCGGATCGCTACAACGCTCTCTATTCTCGAGAATAGAGAGCGTTGTAGCGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)