EMAIL THIS PAGE TO A FRIEND

F8a

14 Gene Product Result for
Species: Mouse F8a(14070)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H2539 Anti-HAP40 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007978 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007978 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007978 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU175321 MISSION® esiRNA targeting mouse F8a mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007978 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007978 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066118 predicted 543
2 SASI_Mm01_00066119 predicted 1589
3 SASI_Mm01_00066120 predicted 578
4 SASI_Mm02_00312881 predicted 1476
5 SASI_Mm02_00312882 predicted 1535
6 SASI_Mm01_00066122 predicted 735
7 SASI_Mm01_00066123 predicted 442
8 SASI_Mm01_00066124 predicted 273
9 SASI_Mm01_00066125 predicted 1640
10 SASI_Mm01_00066126 predicted 941
11 SASI_Mm01_00066117 predicted 888
12 SASI_Mm01_00066121 predicted 1566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007978
F8a MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000177792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007978.1-1612s1c1
Sequence:CCGGCCATCCATTATTGCCTCGAATCTCGAGATTCGAGGCAATAATGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007978.1-896s1c1
Sequence:CCGGCGCTATTTACACGCATGCAACCTCGAGGTTGCATGCGTGTAAATAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007978.1-1396s1c1
Sequence:CCGGGTTCTGCAGGAAACCATCTCTCTCGAGAGAGATGGTTTCCTGCAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007978.1-384s1c1
Sequence:CCGGCAACAAGCTCAAGAAGCGCTTCTCGAGAAGCGCTTCTTGAGCTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007978.1-1601s1c1
Sequence:CCGGGCCCTCCAATTCCATCCATTACTCGAGTAATGGATGGAATTGGAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007978
F8a MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000177792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007978.1-1612s1c1
Sequence:CCGGCCATCCATTATTGCCTCGAATCTCGAGATTCGAGGCAATAATGGATGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000200163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007978.1-896s1c1
Sequence:CCGGCGCTATTTACACGCATGCAACCTCGAGGTTGCATGCGTGTAAATAGCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000182322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007978.1-1396s1c1
Sequence:CCGGGTTCTGCAGGAAACCATCTCTCTCGAGAGAGATGGTTTCCTGCAGAACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000182211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007978.1-384s1c1
Sequence:CCGGCAACAAGCTCAAGAAGCGCTTCTCGAGAAGCGCTTCTTGAGCTTGTTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000182725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007978.1-1601s1c1
Sequence:CCGGGCCCTCCAATTCCATCCATTACTCGAGTAATGGATGGAATTGGAGGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007978
F8a MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000177792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007978.1-1612s1c1
Sequence:CCGGCCATCCATTATTGCCTCGAATCTCGAGATTCGAGGCAATAATGGATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007978.1-896s1c1
Sequence:CCGGCGCTATTTACACGCATGCAACCTCGAGGTTGCATGCGTGTAAATAGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007978.1-1396s1c1
Sequence:CCGGGTTCTGCAGGAAACCATCTCTCTCGAGAGAGATGGTTTCCTGCAGAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007978.1-384s1c1
Sequence:CCGGCAACAAGCTCAAGAAGCGCTTCTCGAGAAGCGCTTCTTGAGCTTGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007978.1-1601s1c1
Sequence:CCGGGCCCTCCAATTCCATCCATTACTCGAGTAATGGATGGAATTGGAGGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)