EMAIL THIS PAGE TO A FRIEND

FAM120A

family with sequence similarity 120A

190 Gene Product Result for
Synonyms: C9orf10 DNAPTP1 DNAPTP5 OSSA
Gene ID:
Mouse(218236) family with sequence similarity 120, member A
Rat(291019) family with sequence similarity 120A
sheep(101111349) family with sequence similarity 120A
domestic guinea pig(100725460) family with sequence similarity 120A
naked mole-rat(101722075) family with sequence similarity 120A
chicken(415983) family with sequence similarity 120A
domestic cat(101083883) family with sequence similarity 120A
cow(507997) family with sequence similarity 120A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA019734 Anti-FAM120A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2100751 Anti-FAM120A antibody produced in rabbit affinity isolated antibody rat, mouse, rabbit, human, horse, bovine
western blot pricing
HPA055800 Anti-FAM120A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB3500232 Anti-FAM120A antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2702121 Anti-FAM120A antibody produced in rabbit human
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014612 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014612 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014612 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033268 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033268 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033268 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014612 Rosetta Predictions human pricing
XM_237998 Rosetta Predictions rat pricing
NM_001033268 Rosetta Predictions mouse pricing
XM_990484 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149752 predicted 783
2 SASI_Hs02_00345898 predicted 1241
3 SASI_Hs02_00345899 predicted 1227
4 SASI_Hs01_00149753 predicted 1837
5 SASI_Hs01_00149755 predicted 3399
6 SASI_Hs01_00149756 predicted 1012
7 SASI_Hs01_00149757 predicted 577
8 SASI_Hs01_00149758 predicted 1911
9 SASI_Hs02_00345900 predicted 1368
10 SASI_Hs01_00149759 predicted 2319
11 SASI_Hs01_00149750 predicted 3263
12 SASI_Hs01_00149751 predicted 953
13 SASI_Hs01_00149754 predicted 3256
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237998 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391136 predicted 3069
2 SASI_Rn02_00391137 predicted 2821
3 SASI_Rn02_00391138 predicted 1175
4 SASI_Rn02_00391139 predicted 2346
5 SASI_Rn02_00391140 predicted 1620
6 SASI_Rn02_00391141 predicted 3906
7 SASI_Rn02_00391142 predicted 2220
8 SASI_Rn02_00391143 predicted 3538
9 SASI_Rn02_00391144 predicted 1251
10 SASI_Rn02_00391145 predicted 2028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033268 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288448 predicted 1805
2 SASI_Mm02_00288449 predicted 3202
3 SASI_Mm02_00288450 predicted 2287
4 SASI_Mm02_00288451 predicted 1085
5 SASI_Mm02_00288452 predicted 2947
6 SASI_Mm02_00288453 predicted 984
7 SASI_Mm02_00288454 predicted 1674
8 SASI_Mm02_00288455 predicted 711
9 SASI_Mm02_00288456 predicted 1554
10 SASI_Mm02_00288457 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_990484 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250880 predicted 517
2 SASI_Mm01_00250881 predicted 742
3 SASI_Mm01_00250882 predicted 725
4 SASI_Mm01_00250883 predicted 1653
5 SASI_Mm01_00250884 predicted 2043
6 SASI_Mm01_00250885 predicted 1527
7 SASI_Mm01_00250886 predicted 1400
8 SASI_Mm01_00250887 predicted 2065
9 SASI_Mm01_00250888 predicted 496
10 SASI_Mm01_00250889 predicted 2088
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014612
VALIDATED
FAM120A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 120A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014612.2-3815s1c1
Sequence:CCGGGCTTTCTTTAAGGCTTTGATTCTCGAGAATCAAAGCCTTAAAGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014612.2-3285s1c1
Sequence:CCGGCGTGCAATACAAATCCTCATTCTCGAGAATGAGGATTTGTATTGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014612.2-776s1c1
Sequence:CCGGGCTTCCTTTCACTGGAGTTTACTCGAGTAAACTCCAGTGAAAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014612.2-3263s1c1
Sequence:CCGGGCCTTGAATAATGACTCTAAACTCGAGTTTAGAGTCATTATTCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014612.2-884s1c1
Sequence:CCGGGCTGACTATGTACGCAACATTCTCGAGAATGTTGCGTACATAGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014612
VALIDATED
FAM120A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 120A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014612.2-3815s1c1
Sequence:CCGGGCTTTCTTTAAGGCTTTGATTCTCGAGAATCAAAGCCTTAAAGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014612.2-3285s1c1
Sequence:CCGGCGTGCAATACAAATCCTCATTCTCGAGAATGAGGATTTGTATTGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014612.2-776s1c1
Sequence:CCGGGCTTCCTTTCACTGGAGTTTACTCGAGTAAACTCCAGTGAAAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014612.2-3263s1c1
Sequence:CCGGGCCTTGAATAATGACTCTAAACTCGAGTTTAGAGTCATTATTCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014612.2-884s1c1
Sequence:CCGGGCTGACTATGTACGCAACATTCTCGAGAATGTTGCGTACATAGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014612
VALIDATED
FAM120A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 120A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014612.2-3815s1c1
Sequence:CCGGGCTTTCTTTAAGGCTTTGATTCTCGAGAATCAAAGCCTTAAAGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014612.2-3285s1c1
Sequence:CCGGCGTGCAATACAAATCCTCATTCTCGAGAATGAGGATTTGTATTGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014612.2-776s1c1
Sequence:CCGGGCTTCCTTTCACTGGAGTTTACTCGAGTAAACTCCAGTGAAAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014612.2-3263s1c1
Sequence:CCGGGCCTTGAATAATGACTCTAAACTCGAGTTTAGAGTCATTATTCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014612.2-884s1c1
Sequence:CCGGGCTGACTATGTACGCAACATTCTCGAGAATGTTGCGTACATAGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033268
VALIDATED
FAM120A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 120A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033268.2-963s21c1
Sequence:CCGGTAAGAGAGCAGTTGGATATTACTCGAGTAATATCCAACTGCTCTCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283467    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033268.2-4373s21c1
Sequence:CCGGCCGTTTGGAATATCAACATTACTCGAGTAATGTTGATATTCCAAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033268.2-848s21c1
Sequence:CCGGTCAAAGCCGTAGCTGATTATGCTCGAGCATAATCAGCTACGGCTTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033268.2-1799s21c1
Sequence:CCGGATAGGCCAGTTCGTCAGTATGCTCGAGCATACTGACGAACTGGCCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033268.2-2140s21c1
Sequence:CCGGTGCTGCGTCTTACGGTATATGCTCGAGCATATACCGTAAGACGCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033268
VALIDATED
FAM120A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 120A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033268.2-963s21c1
Sequence:CCGGTAAGAGAGCAGTTGGATATTACTCGAGTAATATCCAACTGCTCTCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283467    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033268.2-4373s21c1
Sequence:CCGGCCGTTTGGAATATCAACATTACTCGAGTAATGTTGATATTCCAAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033268.2-848s21c1
Sequence:CCGGTCAAAGCCGTAGCTGATTATGCTCGAGCATAATCAGCTACGGCTTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033268.2-1799s21c1
Sequence:CCGGATAGGCCAGTTCGTCAGTATGCTCGAGCATACTGACGAACTGGCCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033268.2-2140s21c1
Sequence:CCGGTGCTGCGTCTTACGGTATATGCTCGAGCATATACCGTAAGACGCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033268
VALIDATED
FAM120A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 120A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033268.2-963s21c1
Sequence:CCGGTAAGAGAGCAGTTGGATATTACTCGAGTAATATCCAACTGCTCTCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283467    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033268.2-4373s21c1
Sequence:CCGGCCGTTTGGAATATCAACATTACTCGAGTAATGTTGATATTCCAAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033268.2-848s21c1
Sequence:CCGGTCAAAGCCGTAGCTGATTATGCTCGAGCATAATCAGCTACGGCTTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033268.2-1799s21c1
Sequence:CCGGATAGGCCAGTTCGTCAGTATGCTCGAGCATACTGACGAACTGGCCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033268.2-2140s21c1
Sequence:CCGGTGCTGCGTCTTACGGTATATGCTCGAGCATATACCGTAAGACGCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)