EMAIL THIS PAGE TO A FRIEND

FAM151B

family with sequence similarity 151, member B

72 Gene Product Result for
Synonyms: UNQ9217
UniProtKB ID: Q6UXP7, A2RRE4
Gene ID:
Mouse(73942) family with sequence similarity 151, member B
Rat(499507) family with sequence similarity 151, member B
sheep(101120919) family with sequence similarity 151, member B
domestic guinea pig(100730316) family with sequence similarity 151, member B
naked mole-rat(101699774) family with sequence similarity 151, member B
Zebrafish(445137) family with sequence similarity 151, member B
cow(535260) family with sequence similarity 151, member B
domestic cat(101090415) family with sequence similarity 151, member B
dog(479166) family with sequence similarity 151, member B
chicken(427316) family with sequence similarity 151, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_205548 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_205548 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_205548 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001163627 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163627 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163627 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_205548 Rosetta Predictions human pricing
NM_001134748 Rosetta Predictions rat pricing
XM_574832 Rosetta Predictions rat pricing
XM_127489 Rosetta Predictions mouse pricing
XM_912125 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245051 predicted 749
2 SASI_Hs01_00245052 predicted 780
3 SASI_Hs01_00245054 predicted 300
4 SASI_Hs02_00373450 predicted 531
5 SASI_Hs02_00373451 predicted 731
6 SASI_Hs01_00245056 predicted 521
7 SASI_Hs01_00245057 predicted 965
8 SASI_Hs01_00245058 predicted 983
9 SASI_Hs01_00245059 predicted 668
10 SASI_Hs02_00373452 predicted 247
11 SASI_Hs01_00245053 predicted 537
12 SASI_Hs01_00245055 predicted 957
13 SASI_Hs01_00245060 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134748 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258324 predicted 1010
2 SASI_Rn02_00258325 predicted 366
3 SASI_Rn02_00258326 predicted 895
4 SASI_Rn02_00258327 predicted 1058
5 SASI_Rn02_00258328 predicted 1028
6 SASI_Rn02_00258329 predicted 461
7 SASI_Rn02_00258330 predicted 285
8 SASI_Rn02_00258331 predicted 720
9 SASI_Rn02_00258332 predicted 641
10 SASI_Rn02_00258333 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574832 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00171497 predicted 445
2 SASI_Rn01_00171498 predicted 389
3 SASI_Rn01_00171499 predicted 408
4 SASI_Rn01_00171500 predicted 606
5 SASI_Rn01_00171501 predicted 574
6 SASI_Rn01_00171502 predicted 538
7 SASI_Rn01_00171503 predicted 354
8 SASI_Rn01_00171504 predicted 574
9 SASI_Rn01_00171505 predicted 267
10 SASI_Rn01_00171506 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127489 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223311 predicted 779
2 SASI_Mm01_00223312 predicted 305
3 SASI_Mm01_00223313 predicted 1004
4 SASI_Mm01_00223314 predicted 471
5 SASI_Mm01_00223315 predicted 801
6 SASI_Mm02_00424227 predicted 358
7 SASI_Mm01_00223316 predicted 707
8 SASI_Mm01_00223317 predicted 598
9 SASI_Mm02_00424228 predicted 215
10 SASI_Mm01_00223318 predicted 457
11 SASI_Mm01_00223319 predicted 934
12 SASI_Mm01_00223320 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_912125 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00436840 predicted 313
2 SASI_Mm02_00436841 predicted 475
3 SASI_Mm02_00436842 predicted 356
4 SASI_Mm02_00436843 predicted 311
5 SASI_Mm02_00436844 predicted 277
6 SASI_Mm02_00436845 predicted 597
7 SASI_Mm02_00436846 predicted 214
8 SASI_Mm02_00436847 predicted 459
9 SASI_Mm02_00436848 predicted 615
10 SASI_Mm02_00436849 predicted 487
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_205548
FAM151B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 151, member B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205548.1-234s1c1
Sequence:CCGGGCTGAGATCACCTGGTATCATCTCGAGATGATACCAGGTGATCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205548.1-538s1c1
Sequence:CCGGCCGATATTCTTCCTGGTCCAACTCGAGTTGGACCAGGAAGAATATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205548.1-522s1c1
Sequence:CCGGCCTGTATGGATTAATGCCGATCTCGAGATCGGCATTAATCCATACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205548.1-771s1c1
Sequence:CCGGCAGTCTTGTTCTCAGTTACTTCTCGAGAAGTAACTGAGAACAAGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_205548.1-1071s1c1
Sequence:CCGGCGTTCCAAGTCATCTAATCAACTCGAGTTGATTAGATGACTTGGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135345    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205548.1-1018s1c1
Sequence:CCGGCTTCTCTCCATTGGTCTGAATCTCGAGATTCAGACCAATGGAGAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_205548.1-1104s1c1
Sequence:CCGGGTATGCTTACTCTGTGGGCATCTCGAGATGCCCACAGAGTAAGCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205548.1-1182s21c1
Sequence:CCGGCACGTGGCCTAGTCTAATAATCTCGAGATTATTAGACTAGGCCACGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205548.1-345s21c1
Sequence:CCGGGAACACAGCCAGCCAATTATGCTCGAGCATAATTGGCTGGCTGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_205548
FAM151B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 151, member B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205548.1-234s1c1
Sequence:CCGGGCTGAGATCACCTGGTATCATCTCGAGATGATACCAGGTGATCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205548.1-538s1c1
Sequence:CCGGCCGATATTCTTCCTGGTCCAACTCGAGTTGGACCAGGAAGAATATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205548.1-522s1c1
Sequence:CCGGCCTGTATGGATTAATGCCGATCTCGAGATCGGCATTAATCCATACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205548.1-771s1c1
Sequence:CCGGCAGTCTTGTTCTCAGTTACTTCTCGAGAAGTAACTGAGAACAAGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_205548.1-1071s1c1
Sequence:CCGGCGTTCCAAGTCATCTAATCAACTCGAGTTGATTAGATGACTTGGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135345    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205548.1-1018s1c1
Sequence:CCGGCTTCTCTCCATTGGTCTGAATCTCGAGATTCAGACCAATGGAGAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_205548.1-1104s1c1
Sequence:CCGGGTATGCTTACTCTGTGGGCATCTCGAGATGCCCACAGAGTAAGCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205548.1-1182s21c1
Sequence:CCGGCACGTGGCCTAGTCTAATAATCTCGAGATTATTAGACTAGGCCACGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205548.1-345s21c1
Sequence:CCGGGAACACAGCCAGCCAATTATGCTCGAGCATAATTGGCTGGCTGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_205548
FAM151B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 151, member B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205548.1-234s1c1
Sequence:CCGGGCTGAGATCACCTGGTATCATCTCGAGATGATACCAGGTGATCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205548.1-538s1c1
Sequence:CCGGCCGATATTCTTCCTGGTCCAACTCGAGTTGGACCAGGAAGAATATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205548.1-522s1c1
Sequence:CCGGCCTGTATGGATTAATGCCGATCTCGAGATCGGCATTAATCCATACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_205548.1-771s1c1
Sequence:CCGGCAGTCTTGTTCTCAGTTACTTCTCGAGAAGTAACTGAGAACAAGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_205548.1-1071s1c1
Sequence:CCGGCGTTCCAAGTCATCTAATCAACTCGAGTTGATTAGATGACTTGGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135345    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_205548.1-1018s1c1
Sequence:CCGGCTTCTCTCCATTGGTCTGAATCTCGAGATTCAGACCAATGGAGAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_205548.1-1104s1c1
Sequence:CCGGGTATGCTTACTCTGTGGGCATCTCGAGATGCCCACAGAGTAAGCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_205548.1-1182s21c1
Sequence:CCGGCACGTGGCCTAGTCTAATAATCTCGAGATTATTAGACTAGGCCACGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205548.1-345s21c1
Sequence:CCGGGAACACAGCCAGCCAATTATGCTCGAGCATAATTGGCTGGCTGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163627
FAM151B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 151, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163627.1-591s21c1
Sequence:CCGGGGCATCCTGAGAAAGTCAATGCTCGAGCATTGACTTTCTCAGGATGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163627.1-807s21c1
Sequence:CCGGTTTACATTCGAGACTACTTTACTCGAGTAAAGTAGTCTCGAATGTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163627.1-461s21c1
Sequence:CCGGGTGTGGATTAATGCCGATATTCTCGAGAATATCGGCATTAATCCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163627.1-1021s21c1
Sequence:CCGGCTCAATCAATGGCTGTATTAACTCGAGTTAATACAGCCATTGATTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163627.1-228s21c1
Sequence:CCGGAGAGTGCTGCCCACATGATAGCTCGAGCTATCATGTGGGCAGCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163627
FAM151B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 151, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163627.1-591s21c1
Sequence:CCGGGGCATCCTGAGAAAGTCAATGCTCGAGCATTGACTTTCTCAGGATGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163627.1-807s21c1
Sequence:CCGGTTTACATTCGAGACTACTTTACTCGAGTAAAGTAGTCTCGAATGTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163627.1-461s21c1
Sequence:CCGGGTGTGGATTAATGCCGATATTCTCGAGAATATCGGCATTAATCCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163627.1-1021s21c1
Sequence:CCGGCTCAATCAATGGCTGTATTAACTCGAGTTAATACAGCCATTGATTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163627.1-228s21c1
Sequence:CCGGAGAGTGCTGCCCACATGATAGCTCGAGCTATCATGTGGGCAGCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163627
FAM151B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 151, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163627.1-591s21c1
Sequence:CCGGGGCATCCTGAGAAAGTCAATGCTCGAGCATTGACTTTCTCAGGATGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163627.1-807s21c1
Sequence:CCGGTTTACATTCGAGACTACTTTACTCGAGTAAAGTAGTCTCGAATGTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163627.1-461s21c1
Sequence:CCGGGTGTGGATTAATGCCGATATTCTCGAGAATATCGGCATTAATCCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163627.1-1021s21c1
Sequence:CCGGCTCAATCAATGGCTGTATTAACTCGAGTTAATACAGCCATTGATTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163627.1-228s21c1
Sequence:CCGGAGAGTGCTGCCCACATGATAGCTCGAGCTATCATGTGGGCAGCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)