EMAIL THIS PAGE TO A FRIEND

FAM159B

family with sequence similarity 159, member B

71 Gene Product Result for
UniProtKB ID: A6NKW6
Gene ID:
Mouse(77803) family with sequence similarity 159, member B
Rat(499520) family with sequence similarity 159, member B
sheep(101104857) family with sequence similarity 159, member B
domestic guinea pig(100730779) family with sequence similarity 159, member B
naked mole-rat(101717613) family with sequence similarity 159, member B
dog(100688430) family with sequence similarity 159, member B
cow(515994) family with sequence similarity 159, member B
domestic cat(101084596) family with sequence similarity 159, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029984 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029984 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029984 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001720146 Rosetta Predictions human pricing
XM_001720158 Rosetta Predictions human pricing
XM_001722781 Rosetta Predictions human pricing
XM_001072885 Rosetta Predictions rat pricing
XM_574844 Rosetta Predictions rat pricing
NM_029984 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720146 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00434854 predicted 1011
2 SASI_Hs02_00434855 predicted 858
3 SASI_Hs02_00434856 predicted 774
4 SASI_Hs02_00434857 predicted 1088
5 SASI_Hs02_00434858 predicted 335
6 SASI_Hs02_00434859 predicted 656
7 SASI_Hs02_00434860 predicted 630
8 SASI_Hs02_00434861 predicted 507
9 SASI_Hs02_00434862 predicted 653
10 SASI_Hs02_00434863 predicted 1074
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720158 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00434941 predicted 1012
2 SASI_Hs02_00434942 predicted 858
3 SASI_Hs02_00434943 predicted 775
4 SASI_Hs02_00434944 predicted 1092
5 SASI_Hs02_00434945 predicted 656
6 SASI_Hs02_00434946 predicted 636
7 SASI_Hs02_00434947 predicted 498
8 SASI_Hs02_00434948 predicted 647
9 SASI_Hs02_00434949 predicted 639
10 SASI_Hs02_00434950 predicted 1071
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00451270 predicted 1010
2 SASI_Hs02_00451271 predicted 858
3 SASI_Hs02_00451272 predicted 771
4 SASI_Hs02_00451273 predicted 1092
5 SASI_Hs02_00451274 predicted 335
6 SASI_Hs02_00451275 predicted 652
7 SASI_Hs02_00451276 predicted 633
8 SASI_Hs02_00451277 predicted 504
9 SASI_Hs02_00451278 predicted 646
10 SASI_Hs02_00451279 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072885 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340773 predicted 382
2 SASI_Rn02_00340774 predicted 447
3 SASI_Rn02_00340775 predicted 312
4 SASI_Rn02_00340776 predicted 331
5 SASI_Rn02_00340777 predicted 467
6 SASI_Rn02_00340778 predicted 379
7 SASI_Rn02_00340779 predicted 434
8 SASI_Rn02_00340780 predicted 210
9 SASI_Rn02_00340781 predicted 449
10 SASI_Rn02_00340782 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574844 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402690 predicted 560
2 SASI_Rn02_00402691 predicted 620
3 SASI_Rn02_00402692 predicted 489
4 SASI_Rn02_00402693 predicted 510
5 SASI_Rn02_00402694 predicted 645
6 SASI_Rn02_00402695 predicted 313
7 SASI_Rn02_00402696 predicted 552
8 SASI_Rn02_00402697 predicted 615
9 SASI_Rn02_00402698 predicted 512
10 SASI_Rn02_00402699 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029984 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121560 predicted 1018
2 SASI_Mm02_00336324 predicted 441
3 SASI_Mm02_00336325 predicted 426
4 SASI_Mm01_00121562 predicted 1009
5 SASI_Mm01_00121563 predicted 391
6 SASI_Mm01_00121564 predicted 1017
7 SASI_Mm02_00336326 predicted 463
8 SASI_Mm01_00121565 predicted 1038
9 SASI_Mm01_00121566 predicted 279
10 SASI_Mm01_00121567 predicted 269
11 SASI_Mm01_00121561 predicted 439
12 SASI_Mm01_00121568 predicted 348
13 SASI_Mm01_00121569 predicted 1022
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029984
FAM159B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 159, member B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202424    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029984.1-1134s1c1
Sequence:CCGGGCGCAATACGTGGGTTTGTTTCTCGAGAAACAAACCCACGTATTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029984.1-635s1c1
Sequence:CCGGCACAAATCAATATTGCCTGTTCTCGAGAACAGGCAATATTGATTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029984.1-446s1c1
Sequence:CCGGGCTACTTATTTCTGTACACAACTCGAGTTGTGTACAGAAATAAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029984.1-553s21c1
Sequence:CCGGGGCCTCAATGCAGTATCAAATCTCGAGATTTGATACTGCATTGAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029984.1-1121s21c1
Sequence:CCGGCAATCACAGTGAAGCGCAATACTCGAGTATTGCGCTTCACTGTGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029984.1-476s21c1
Sequence:CCGGGATTAGACAATGGCCTTAAACCTCGAGGTTTAAGGCCATTGTCTAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029984.1-519s21c1
Sequence:CCGGTACCCTAGAAGGCAACATAAACTCGAGTTTATGTTGCCTTCTAGGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029984.1-553s1c1
Sequence:CCGGGGCCTCAATGCAGTATCAAATCTCGAGATTTGATACTGCATTGAGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029984.1-436s21c1
Sequence:CCGGTGTGTCCTCTGCTACTTATTTCTCGAGAAATAAGTAGCAGAGGACACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029984
FAM159B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 159, member B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202424    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029984.1-1134s1c1
Sequence:CCGGGCGCAATACGTGGGTTTGTTTCTCGAGAAACAAACCCACGTATTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029984.1-635s1c1
Sequence:CCGGCACAAATCAATATTGCCTGTTCTCGAGAACAGGCAATATTGATTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029984.1-446s1c1
Sequence:CCGGGCTACTTATTTCTGTACACAACTCGAGTTGTGTACAGAAATAAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029984.1-553s21c1
Sequence:CCGGGGCCTCAATGCAGTATCAAATCTCGAGATTTGATACTGCATTGAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029984.1-1121s21c1
Sequence:CCGGCAATCACAGTGAAGCGCAATACTCGAGTATTGCGCTTCACTGTGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029984.1-476s21c1
Sequence:CCGGGATTAGACAATGGCCTTAAACCTCGAGGTTTAAGGCCATTGTCTAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029984.1-519s21c1
Sequence:CCGGTACCCTAGAAGGCAACATAAACTCGAGTTTATGTTGCCTTCTAGGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029984.1-553s1c1
Sequence:CCGGGGCCTCAATGCAGTATCAAATCTCGAGATTTGATACTGCATTGAGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029984.1-436s21c1
Sequence:CCGGTGTGTCCTCTGCTACTTATTTCTCGAGAAATAAGTAGCAGAGGACACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029984
FAM159B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 159, member B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202424    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029984.1-1134s1c1
Sequence:CCGGGCGCAATACGTGGGTTTGTTTCTCGAGAAACAAACCCACGTATTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029984.1-635s1c1
Sequence:CCGGCACAAATCAATATTGCCTGTTCTCGAGAACAGGCAATATTGATTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029984.1-446s1c1
Sequence:CCGGGCTACTTATTTCTGTACACAACTCGAGTTGTGTACAGAAATAAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029984.1-553s21c1
Sequence:CCGGGGCCTCAATGCAGTATCAAATCTCGAGATTTGATACTGCATTGAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029984.1-1121s21c1
Sequence:CCGGCAATCACAGTGAAGCGCAATACTCGAGTATTGCGCTTCACTGTGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029984.1-476s21c1
Sequence:CCGGGATTAGACAATGGCCTTAAACCTCGAGGTTTAAGGCCATTGTCTAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029984.1-519s21c1
Sequence:CCGGTACCCTAGAAGGCAACATAAACTCGAGTTTATGTTGCCTTCTAGGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029984.1-553s1c1
Sequence:CCGGGGCCTCAATGCAGTATCAAATCTCGAGATTTGATACTGCATTGAGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029984.1-436s21c1
Sequence:CCGGTGTGTCCTCTGCTACTTATTTCTCGAGAAATAAGTAGCAGAGGACACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)