EMAIL THIS PAGE TO A FRIEND

FAM163B

family with sequence similarity 163, member B

51 Gene Product Result for
Synonyms: C9orf166
UniProtKB ID: P0C2L3, B2RUZ5
Gene ID:
Mouse(109349) family with sequence similarity 163, member B
Rat(685169) family with sequence similarity 163, member B
sheep(101110928) family with sequence similarity 163, member B
naked mole-rat(101716955) family with sequence similarity 163, member B
domestic guinea pig(100718227) family with sequence similarity 163, member B
domestic cat(101083218) family with sequence similarity 163, member B
dog(608004) family with sequence similarity 163, member B
cow(615192) family with sequence similarity 163, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA067336 Anti-FAM163B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175427 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175427 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175427 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080515 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080515 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080515 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112731 MISSION® esiRNA esiRNA human FAM163B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080515 Rosetta Predictions human pricing
XM_926352 Rosetta Predictions human pricing
NM_001109458 Rosetta Predictions rat pricing
NM_175427 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315587 predicted 261
2 SASI_Hs02_00315588 predicted 24
3 SASI_Hs02_00315589 predicted 31
4 SASI_Hs02_00315590 predicted 128
5 SASI_Hs02_00315591 predicted 175
6 SASI_Hs02_00315592 predicted 351
7 SASI_Hs02_00315593 predicted 161
8 SASI_Hs02_00315594 predicted 130
9 SASI_Hs02_00315595 predicted 176
10 SASI_Hs02_00315596 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926352 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258157 predicted 446
2 SASI_Hs01_00258158 predicted 479
3 SASI_Hs01_00258159 predicted 466
4 SASI_Hs01_00258160 predicted 662
5 SASI_Hs01_00258161 predicted 31
6 SASI_Hs01_00258162 predicted 668
7 SASI_Hs01_00258163 predicted 37
8 SASI_Hs01_00258164 predicted 138
9 SASI_Hs01_00258165 predicted 673
10 SASI_Hs01_00258166 predicted 183
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109458 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248607 predicted 830
2 SASI_Rn02_00248608 predicted 514
3 SASI_Rn02_00248609 predicted 660
4 SASI_Rn02_00248610 predicted 381
5 SASI_Rn02_00248611 predicted 476
6 SASI_Rn02_00248612 predicted 476
7 SASI_Rn02_00248613 predicted 878
8 SASI_Rn02_00248614 predicted 377
9 SASI_Rn02_00248615 predicted 937
10 SASI_Rn02_00248616 predicted 1013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175427 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055212 predicted 410
2 SASI_Mm01_00055213 predicted 828
3 SASI_Mm01_00055214 predicted 513
4 SASI_Mm01_00055215 predicted 661
5 SASI_Mm01_00055217 predicted 1004
6 SASI_Mm01_00055218 predicted 475
7 SASI_Mm01_00055219 predicted 655
8 SASI_Mm01_00055220 predicted 919
9 SASI_Mm01_00055221 predicted 375
10 SASI_Mm02_00346300 predicted 811
11 SASI_Mm01_00055216 predicted 389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175427
FAM163B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 163, member B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192380    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175427.2-1127s1c1
Sequence:CCGGCAGGAAGTGAGAAGATGGATACTCGAGTATCCATCTTCTCACTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175427.2-379s1c1
Sequence:CCGGGCAACTGTGATTCTGCTCTGTCTCGAGACAGAGCAGAATCACAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175427.2-371s1c1
Sequence:CCGGGCATCTTGGCAACTGTGATTCCTCGAGGAATCACAGTTGCCAAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175427.3-437s21c1
Sequence:CCGGCTGCTGCAAGAAGGACGAATCCTCGAGGATTCGTCCTTCTTGCAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175427.3-381s21c1
Sequence:CCGGACTGTGATTCTGCTCTGTATCCTCGAGGATACAGAGCAGAATCACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175427.3-655s21c1
Sequence:CCGGAGCCAGAGGACGAAGACTTTGCTCGAGCAAAGTCTTCGTCCTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175427.3-1129s21c1
Sequence:CCGGGAAGTGAGAAGATGGATAATGCTCGAGCATTATCCATCTTCTCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175427.3-515s21c1
Sequence:CCGGTTCCAACCGCAACCTCGTGTTCTCGAGAACACGAGGTTGCGGTTGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175427
FAM163B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 163, member B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192380    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175427.2-1127s1c1
Sequence:CCGGCAGGAAGTGAGAAGATGGATACTCGAGTATCCATCTTCTCACTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175427.2-379s1c1
Sequence:CCGGGCAACTGTGATTCTGCTCTGTCTCGAGACAGAGCAGAATCACAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175427.2-371s1c1
Sequence:CCGGGCATCTTGGCAACTGTGATTCCTCGAGGAATCACAGTTGCCAAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175427.3-437s21c1
Sequence:CCGGCTGCTGCAAGAAGGACGAATCCTCGAGGATTCGTCCTTCTTGCAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175427.3-381s21c1
Sequence:CCGGACTGTGATTCTGCTCTGTATCCTCGAGGATACAGAGCAGAATCACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175427.3-655s21c1
Sequence:CCGGAGCCAGAGGACGAAGACTTTGCTCGAGCAAAGTCTTCGTCCTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175427.3-1129s21c1
Sequence:CCGGGAAGTGAGAAGATGGATAATGCTCGAGCATTATCCATCTTCTCACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175427.3-515s21c1
Sequence:CCGGTTCCAACCGCAACCTCGTGTTCTCGAGAACACGAGGTTGCGGTTGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175427
FAM163B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 163, member B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192380    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175427.2-1127s1c1
Sequence:CCGGCAGGAAGTGAGAAGATGGATACTCGAGTATCCATCTTCTCACTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175427.2-379s1c1
Sequence:CCGGGCAACTGTGATTCTGCTCTGTCTCGAGACAGAGCAGAATCACAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175427.2-371s1c1
Sequence:CCGGGCATCTTGGCAACTGTGATTCCTCGAGGAATCACAGTTGCCAAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175427.3-437s21c1
Sequence:CCGGCTGCTGCAAGAAGGACGAATCCTCGAGGATTCGTCCTTCTTGCAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175427.3-381s21c1
Sequence:CCGGACTGTGATTCTGCTCTGTATCCTCGAGGATACAGAGCAGAATCACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175427.3-655s21c1
Sequence:CCGGAGCCAGAGGACGAAGACTTTGCTCGAGCAAAGTCTTCGTCCTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175427.3-1129s21c1
Sequence:CCGGGAAGTGAGAAGATGGATAATGCTCGAGCATTATCCATCTTCTCACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175427.3-515s21c1
Sequence:CCGGTTCCAACCGCAACCTCGTGTTCTCGAGAACACGAGGTTGCGGTTGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080515
FAM163B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 163, member B
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000284063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080515.1-327s21c1
Sequence:CCGGGGAGGAAGAGGACGTGCTGAACTCGAGTTCAGCACGTCCTCTTCCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080515.1-90s21c1
Sequence:CCGGCCAGTACTACTGCTGCAAGAACTCGAGTTCTTGCAGCAGTAGTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080515.1-138s21c1
Sequence:CCGGACCAGACTTCGCCGTTCACTCCTCGAGGAGTGAACGGCGAAGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080515.1-54s21c1
Sequence:CCGGGCTCTGCATCATCGCTGTTCTCTCGAGAGAACAGCGATGATGCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080515
FAM163B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 163, member B
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000284063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080515.1-327s21c1
Sequence:CCGGGGAGGAAGAGGACGTGCTGAACTCGAGTTCAGCACGTCCTCTTCCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080515.1-90s21c1
Sequence:CCGGCCAGTACTACTGCTGCAAGAACTCGAGTTCTTGCAGCAGTAGTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080515.1-138s21c1
Sequence:CCGGACCAGACTTCGCCGTTCACTCCTCGAGGAGTGAACGGCGAAGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080515.1-54s21c1
Sequence:CCGGGCTCTGCATCATCGCTGTTCTCTCGAGAGAACAGCGATGATGCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080515
FAM163B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 163, member B
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000284063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080515.1-327s21c1
Sequence:CCGGGGAGGAAGAGGACGTGCTGAACTCGAGTTCAGCACGTCCTCTTCCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080515.1-90s21c1
Sequence:CCGGCCAGTACTACTGCTGCAAGAACTCGAGTTCTTGCAGCAGTAGTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080515.1-138s21c1
Sequence:CCGGACCAGACTTCGCCGTTCACTCCTCGAGGAGTGAACGGCGAAGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080515.1-54s21c1
Sequence:CCGGGCTCTGCATCATCGCTGTTCTCTCGAGAGAACAGCGATGATGCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)