EMAIL THIS PAGE TO A FRIEND

FAM171B

family with sequence similarity 171, member B

190 Gene Product Result for
Synonyms: KIAA1946
Gene ID:
Mouse(241520) family with sequence similarity 171, member B
Rat(499821) family with sequence similarity 171, member B
chicken(423991) family with sequence similarity 171, member B
cow(614438) family with sequence similarity 171, member B
dog(611224) family with sequence similarity 171, member B
domestic cat(101098565) family with sequence similarity 171, member B
sheep(101116019) family with sequence similarity 171, member B
domestic guinea pig(100728291) family with sequence similarity 171, member B
naked mole-rat(101717326) family with sequence similarity 171, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177454 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177454 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177454 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175514 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175514 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175514 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177454 Rosetta Predictions human pricing
XM_001068767 Rosetta Predictions rat pricing
XM_575160 Rosetta Predictions rat pricing
NM_175514 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108318 predicted 1818
2 SASI_Hs02_00369346 predicted 1960
3 SASI_Hs01_00108320 predicted 2531
4 SASI_Hs01_00108322 predicted 894
5 SASI_Hs01_00108323 predicted 747
6 SASI_Hs01_00108324 predicted 2335
7 SASI_Hs01_00108326 predicted 1758
8 SASI_Hs01_00108327 predicted 618
9 SASI_Hs02_00369347 predicted 1193
10 SASI_Hs02_00369348 predicted 2685
11 SASI_Hs01_00108319 predicted 806
12 SASI_Hs01_00108321 predicted 2332
13 SASI_Hs01_00108325 predicted 1383
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068767 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325766 predicted 1602
2 SASI_Rn02_00325767 predicted 2537
3 SASI_Rn02_00325768 predicted 2133
4 SASI_Rn02_00325769 predicted 824
5 SASI_Rn02_00325770 predicted 1205
6 SASI_Rn02_00325771 predicted 1421
7 SASI_Rn02_00325772 predicted 826
8 SASI_Rn02_00325773 predicted 1296
9 SASI_Rn02_00325774 predicted 1226
10 SASI_Rn02_00325775 predicted 1503
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575160 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403191 predicted 1425
2 SASI_Rn02_00403192 predicted 649
3 SASI_Rn02_00403193 predicted 1019
4 SASI_Rn02_00403194 predicted 1246
5 SASI_Rn02_00403195 predicted 1104
6 SASI_Rn02_00403196 predicted 645
7 SASI_Rn02_00403197 predicted 1112
8 SASI_Rn02_00403198 predicted 1052
9 SASI_Rn02_00403199 predicted 1261
10 SASI_Rn02_00403200 predicted 1332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020516 predicted 2207
2 SASI_Mm02_00346443 predicted 528
3 SASI_Mm01_00020517 predicted 958
4 SASI_Mm01_00020518 predicted 497
5 SASI_Mm01_00020519 predicted 1010
6 SASI_Mm01_00020520 predicted 2270
7 SASI_Mm01_00020521 predicted 2422
8 SASI_Mm01_00020522 predicted 938
9 SASI_Mm01_00020523 predicted 1216
10 SASI_Mm01_00020525 predicted 868
11 SASI_Mm01_00020524 predicted 492
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177454
VALIDATED
FAM171B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 171, member B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177454.3-2988s21c1
Sequence:CCGGCTGACTTCAGGCATCATATTACTCGAGTAATATGATGCCTGAAGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177454.3-2795s21c1
Sequence:CCGAGATGAATTTACAGTATCTAAGCTCGAGCTTAGATACTGTAAATTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177454.3-748s21c1
Sequence:CCGGCAACGTTACTGGCTATCTTACCTCGAGGTAAGATAGCCAGTAACGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177454.3-2650s21c1
Sequence:CCGGTAAATTGCAGTACGAACTTAACTCGAGTTAAGTTCGTACTGCAATTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177454.3-1002s21c1
Sequence:CCGGACACAGGTGCTTGGGTAAATCCTCGAGGATTTACCCAAGCACCTGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177454.2-1770s1c1
Sequence:CCGGCGGAACAATTACATACTGCTACTCGAGTAGCAGTATGTAATTGTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_177454.2-447s1c1
Sequence:CCGGCGAAGACAAATTCCACAGTAACTCGAGTTACTGTGGAATTTGTCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_177454.2-2176s1c1
Sequence:CCGGGCACTCCTTTATAGACCTGAACTCGAGTTCAGGTCTATAAAGGAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_177454.2-2576s1c1
Sequence:CCGGCGCCCACTGATTCCCATAAATCTCGAGATTTATGGGAATCAGTGGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177454.2-501s1c1
Sequence:CCGGCCTACAAATTAGGACTTAGTTCTCGAGAACTAAGTCCTAATTTGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177454
VALIDATED
FAM171B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 171, member B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177454.3-2988s21c1
Sequence:CCGGCTGACTTCAGGCATCATATTACTCGAGTAATATGATGCCTGAAGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177454.3-2795s21c1
Sequence:CCGAGATGAATTTACAGTATCTAAGCTCGAGCTTAGATACTGTAAATTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177454.3-748s21c1
Sequence:CCGGCAACGTTACTGGCTATCTTACCTCGAGGTAAGATAGCCAGTAACGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177454.3-2650s21c1
Sequence:CCGGTAAATTGCAGTACGAACTTAACTCGAGTTAAGTTCGTACTGCAATTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177454.3-1002s21c1
Sequence:CCGGACACAGGTGCTTGGGTAAATCCTCGAGGATTTACCCAAGCACCTGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177454.2-1770s1c1
Sequence:CCGGCGGAACAATTACATACTGCTACTCGAGTAGCAGTATGTAATTGTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_177454.2-447s1c1
Sequence:CCGGCGAAGACAAATTCCACAGTAACTCGAGTTACTGTGGAATTTGTCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_177454.2-2176s1c1
Sequence:CCGGGCACTCCTTTATAGACCTGAACTCGAGTTCAGGTCTATAAAGGAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_177454.2-2576s1c1
Sequence:CCGGCGCCCACTGATTCCCATAAATCTCGAGATTTATGGGAATCAGTGGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177454.2-501s1c1
Sequence:CCGGCCTACAAATTAGGACTTAGTTCTCGAGAACTAAGTCCTAATTTGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177454
VALIDATED
FAM171B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 171, member B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177454.3-2988s21c1
Sequence:CCGGCTGACTTCAGGCATCATATTACTCGAGTAATATGATGCCTGAAGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177454.3-2795s21c1
Sequence:CCGAGATGAATTTACAGTATCTAAGCTCGAGCTTAGATACTGTAAATTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177454.3-748s21c1
Sequence:CCGGCAACGTTACTGGCTATCTTACCTCGAGGTAAGATAGCCAGTAACGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177454.3-2650s21c1
Sequence:CCGGTAAATTGCAGTACGAACTTAACTCGAGTTAAGTTCGTACTGCAATTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177454.3-1002s21c1
Sequence:CCGGACACAGGTGCTTGGGTAAATCCTCGAGGATTTACCCAAGCACCTGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177454.2-1770s1c1
Sequence:CCGGCGGAACAATTACATACTGCTACTCGAGTAGCAGTATGTAATTGTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_177454.2-447s1c1
Sequence:CCGGCGAAGACAAATTCCACAGTAACTCGAGTTACTGTGGAATTTGTCTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_177454.2-2176s1c1
Sequence:CCGGGCACTCCTTTATAGACCTGAACTCGAGTTCAGGTCTATAAAGGAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_177454.2-2576s1c1
Sequence:CCGGCGCCCACTGATTCCCATAAATCTCGAGATTTATGGGAATCAGTGGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177454.2-501s1c1
Sequence:CCGGCCTACAAATTAGGACTTAGTTCTCGAGAACTAAGTCCTAATTTGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175514
VALIDATED
FAM171B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 171, member B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000125289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175514.1-2914s1c1
Sequence:CCGGGCTTAGAAACAACCTGATAAACTCGAGTTTATCAGGTTGTTTCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175514.1-2063s1c1
Sequence:CCGGCACTCCTTTATAGACCTGAAACTCGAGTTTCAGGTCTATAAAGGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175514.1-837s1c1
Sequence:CCGGCCCTTCTACATACAAGTAATACTCGAGTATTACTTGTATGTAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175514.1-1857s1c1
Sequence:CCGGCCTCAGATTGGAGCCGATATTCTCGAGAATATCGGCTCCAATCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175514
VALIDATED
FAM171B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 171, member B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000125289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175514.1-2914s1c1
Sequence:CCGGGCTTAGAAACAACCTGATAAACTCGAGTTTATCAGGTTGTTTCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175514.1-2063s1c1
Sequence:CCGGCACTCCTTTATAGACCTGAAACTCGAGTTTCAGGTCTATAAAGGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175514.1-837s1c1
Sequence:CCGGCCCTTCTACATACAAGTAATACTCGAGTATTACTTGTATGTAGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175514.1-1857s1c1
Sequence:CCGGCCTCAGATTGGAGCCGATATTCTCGAGAATATCGGCTCCAATCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175514
VALIDATED
FAM171B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 171, member B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000125289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175514.1-2914s1c1
Sequence:CCGGGCTTAGAAACAACCTGATAAACTCGAGTTTATCAGGTTGTTTCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175514.1-2063s1c1
Sequence:CCGGCACTCCTTTATAGACCTGAAACTCGAGTTTCAGGTCTATAAAGGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175514.1-837s1c1
Sequence:CCGGCCCTTCTACATACAAGTAATACTCGAGTATTACTTGTATGTAGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175514.1-1857s1c1
Sequence:CCGGCCTCAGATTGGAGCCGATATTCTCGAGAATATCGGCTCCAATCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)