EMAIL THIS PAGE TO A FRIEND

FAM177B

family with sequence similarity 177, member B

62 Gene Product Result for
UniProtKB ID: A6PVY3, Q6ZUN8
Gene ID:
dog(478995) family with sequence similarity 177, member B
cow(100847316) family with sequence similarity 177, member B
domestic cat(101101286) family with sequence similarity 177, member B
sheep(101107540) family with sequence similarity 177, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207468 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207468 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207468 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126371 MISSION® esiRNA esiRNA human FAM177B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207468 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374094 predicted 876
2 SASI_Hs02_00374095 predicted 880
3 SASI_Hs02_00374096 predicted 773
4 SASI_Hs02_00374097 predicted 1028
5 SASI_Hs02_00374098 predicted 916
6 SASI_Hs02_00374099 predicted 792
7 SASI_Hs02_00374100 predicted 910
8 SASI_Hs02_00374101 predicted 827
9 SASI_Hs02_00374102 predicted 1004
10 SASI_Hs02_00374103 predicted 878
11 SASI_Hs01_00094634 predicted 958
12 SASI_Hs01_00094635 predicted 1068
13 SASI_Hs01_00094636 predicted 895
14 SASI_Hs01_00094637 predicted 889
15 SASI_Hs01_00094638 predicted 883
16 SASI_Hs01_00094639 predicted 969
17 SASI_Hs01_00094640 predicted 1083
18 SASI_Hs01_00094641 predicted 762
19 SASI_Hs01_00094642 predicted 879
20 SASI_Hs01_00094643 predicted 488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207468
VALIDATED
FAM177B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 177, member B
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207468.1-300s1c1
Sequence:CCGGGAGAAGAGTGTACCTTCCAAACTCGAGTTTGGAAGGTACACTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166993    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207468.1-1419s1c1
Sequence:CCGGCCAGGAATTACAAGCAATAATCTCGAGATTATTGCTTGTAATTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207468.1-483s1c1
Sequence:CCGGCGAATAGCAAGCACCTCATTTCTCGAGAAATGAGGTGCTTGCTATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207468.2-352s21c1
Sequence:CCGGTTGACGGAGACATCATGGAAGCTCGAGCTTCCATGATGTCTCCGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207468.2-621s21c1
Sequence:CCGGAGTGAAAGGAGAGGATCAAAGCTCGAGCTTTGATCCTCTCCTTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207468.2-715s21c1
Sequence:CCGGAGGATGTGACAGAGGCCATTCCTCGAGGAATGGCCTCTGTCACATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207468.2-571s21c1
Sequence:CCGGATGTGTTAAACGAGTTCTATACTCGAGTATAGAACTCGTTTAACACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207468.2-645s21c1
Sequence:CCGGCAGGCAGCTGAGGTTCCTAATCTCGAGATTAGGAACCTCAGCTGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207468.2-1029s21c1
Sequence:CCGGACATTTGCACAGTAGCATAAACTCGAGTTTATGCTACTGTGCAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_207468.2-1147s21c1
Sequence:CCGGGGGCACCGCAAAGTCTAAATACTCGAGTATTTAGACTTTGCGGTGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_207468.2-431s21c1
Sequence:CCGGACTTGACCCTTCTAAACTTTCCTCGAGGAAAGTTTAGAAGGGTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207468.2-546s21c1
Sequence:CCGGGGTCTTACTCAACCCAAATATCTCGAGATATTTGGGTTGAGTAAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207468
VALIDATED
FAM177B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 177, member B
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207468.1-300s1c1
Sequence:CCGGGAGAAGAGTGTACCTTCCAAACTCGAGTTTGGAAGGTACACTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166993    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207468.1-1419s1c1
Sequence:CCGGCCAGGAATTACAAGCAATAATCTCGAGATTATTGCTTGTAATTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207468.1-483s1c1
Sequence:CCGGCGAATAGCAAGCACCTCATTTCTCGAGAAATGAGGTGCTTGCTATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207468.2-352s21c1
Sequence:CCGGTTGACGGAGACATCATGGAAGCTCGAGCTTCCATGATGTCTCCGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207468.2-621s21c1
Sequence:CCGGAGTGAAAGGAGAGGATCAAAGCTCGAGCTTTGATCCTCTCCTTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207468.2-715s21c1
Sequence:CCGGAGGATGTGACAGAGGCCATTCCTCGAGGAATGGCCTCTGTCACATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207468.2-571s21c1
Sequence:CCGGATGTGTTAAACGAGTTCTATACTCGAGTATAGAACTCGTTTAACACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207468.2-645s21c1
Sequence:CCGGCAGGCAGCTGAGGTTCCTAATCTCGAGATTAGGAACCTCAGCTGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207468.2-1029s21c1
Sequence:CCGGACATTTGCACAGTAGCATAAACTCGAGTTTATGCTACTGTGCAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_207468.2-1147s21c1
Sequence:CCGGGGGCACCGCAAAGTCTAAATACTCGAGTATTTAGACTTTGCGGTGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_207468.2-431s21c1
Sequence:CCGGACTTGACCCTTCTAAACTTTCCTCGAGGAAAGTTTAGAAGGGTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207468.2-546s21c1
Sequence:CCGGGGTCTTACTCAACCCAAATATCTCGAGATATTTGGGTTGAGTAAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207468
VALIDATED
FAM177B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 177, member B
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207468.1-300s1c1
Sequence:CCGGGAGAAGAGTGTACCTTCCAAACTCGAGTTTGGAAGGTACACTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166993    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207468.1-1419s1c1
Sequence:CCGGCCAGGAATTACAAGCAATAATCTCGAGATTATTGCTTGTAATTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207468.1-483s1c1
Sequence:CCGGCGAATAGCAAGCACCTCATTTCTCGAGAAATGAGGTGCTTGCTATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207468.2-352s21c1
Sequence:CCGGTTGACGGAGACATCATGGAAGCTCGAGCTTCCATGATGTCTCCGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207468.2-621s21c1
Sequence:CCGGAGTGAAAGGAGAGGATCAAAGCTCGAGCTTTGATCCTCTCCTTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207468.2-715s21c1
Sequence:CCGGAGGATGTGACAGAGGCCATTCCTCGAGGAATGGCCTCTGTCACATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207468.2-571s21c1
Sequence:CCGGATGTGTTAAACGAGTTCTATACTCGAGTATAGAACTCGTTTAACACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207468.2-645s21c1
Sequence:CCGGCAGGCAGCTGAGGTTCCTAATCTCGAGATTAGGAACCTCAGCTGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207468.2-1029s21c1
Sequence:CCGGACATTTGCACAGTAGCATAAACTCGAGTTTATGCTACTGTGCAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_207468.2-1147s21c1
Sequence:CCGGGGGCACCGCAAAGTCTAAATACTCGAGTATTTAGACTTTGCGGTGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_207468.2-431s21c1
Sequence:CCGGACTTGACCCTTCTAAACTTTCCTCGAGGAAAGTTTAGAAGGGTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207468.2-546s21c1
Sequence:CCGGGGTCTTACTCAACCCAAATATCTCGAGATATTTGGGTTGAGTAAGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)