EMAIL THIS PAGE TO A FRIEND

FAM189A1

family with sequence similarity 189, member A1

54 Gene Product Result for
Synonyms: TMEM228
UniProtKB ID: O60320, A0PK09
Gene ID:
Mouse(70638) family with sequence similarity 189, member A1
Rat(680344) family with sequence similarity 189, member A1
sheep(101111054) family with sequence similarity 189, member A1
domestic guinea pig(100718976) family with sequence similarity 189, member A1
naked mole-rat(101726278) family with sequence similarity 189, member A1
Zebrafish(436705) family with sequence similarity 189, member A1
chicken(415387) family with sequence similarity 189, member A1
dog(100684763) family with sequence similarity 189, member A1
cow(100295902) family with sequence similarity 189, member A1
domestic cat(101085213) family with sequence similarity 189, member A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183087 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183087 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183087 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015307 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015307 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015307 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015307 Rosetta Predictions human pricing
XM_001056777 Rosetta Predictions rat pricing
NM_183087 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015307 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347534 predicted 1964
2 SASI_Hs02_00347535 predicted 1949
3 SASI_Hs02_00347536 predicted 1653
4 SASI_Hs02_00347537 predicted 1951
5 SASI_Hs02_00347538 predicted 372
6 SASI_Hs02_00347539 predicted 305
7 SASI_Hs02_00347540 predicted 513
8 SASI_Hs02_00347541 predicted 1608
9 SASI_Hs02_00347542 predicted 756
10 SASI_Hs02_00347543 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056777 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284401 predicted 724
2 SASI_Rn02_00284402 predicted 1365
3 SASI_Rn02_00284403 predicted 1089
4 SASI_Rn02_00284404 predicted 1273
5 SASI_Rn02_00284405 predicted 783
6 SASI_Rn02_00284406 predicted 1087
7 SASI_Rn02_00284407 predicted 1199
8 SASI_Rn02_00284408 predicted 1187
9 SASI_Rn02_00284409 predicted 1219
10 SASI_Rn02_00284410 predicted 1274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183087 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350065 predicted 1001
2 SASI_Mm02_00350066 predicted 1898
3 SASI_Mm02_00350067 predicted 1957
4 SASI_Mm02_00350068 predicted 828
5 SASI_Mm02_00350069 predicted 953
6 SASI_Mm02_00350070 predicted 817
7 SASI_Mm02_00350071 predicted 2032
8 SASI_Mm02_00350072 predicted 1032
9 SASI_Mm02_00350073 predicted 583
10 SASI_Mm01_00104802 predicted 1544
11 SASI_Mm01_00104801 predicted 997
12 SASI_Mm01_00104803 predicted 625
13 SASI_Mm01_00104804 predicted 639
14 SASI_Mm01_00104805 predicted 867
15 SASI_Mm01_00104806 predicted 641
16 SASI_Mm01_00104807 predicted 704
17 SASI_Mm01_00104808 predicted 931
18 SASI_Mm01_00104809 predicted 829
19 SASI_Mm01_00104810 predicted 846
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183087
FAM189A1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 189, member A1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183087.4-465s21c1
Sequence:CCGGGGCCTCTCTCGCTTGTGATTACTCGAGTAATCACAAGCGAGAGAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183087.4-436s21c1
Sequence:CCGGTGGACTCATTGGTGTTGTTTCCTCGAGGAAACAACACCAATGAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183087.4-1483s21c1
Sequence:CCGGATCCACTGGTGACCCAGATACCTCGAGGTATCTGGGTCACCAGTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183087.4-907s21c1
Sequence:CCGGTCTGGACTTTGATGAGTTTATCTCGAGATAAACTCATCAAAGTCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183087.4-2554s21c1
Sequence:CCGGTGTATCTGACCTCACCTAATTCTCGAGAATTAGGTGAGGTCAGATACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183087
FAM189A1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 189, member A1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183087.4-465s21c1
Sequence:CCGGGGCCTCTCTCGCTTGTGATTACTCGAGTAATCACAAGCGAGAGAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183087.4-436s21c1
Sequence:CCGGTGGACTCATTGGTGTTGTTTCCTCGAGGAAACAACACCAATGAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183087.4-1483s21c1
Sequence:CCGGATCCACTGGTGACCCAGATACCTCGAGGTATCTGGGTCACCAGTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183087.4-907s21c1
Sequence:CCGGTCTGGACTTTGATGAGTTTATCTCGAGATAAACTCATCAAAGTCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183087.4-2554s21c1
Sequence:CCGGTGTATCTGACCTCACCTAATTCTCGAGAATTAGGTGAGGTCAGATACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183087
FAM189A1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 189, member A1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183087.4-465s21c1
Sequence:CCGGGGCCTCTCTCGCTTGTGATTACTCGAGTAATCACAAGCGAGAGAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183087.4-436s21c1
Sequence:CCGGTGGACTCATTGGTGTTGTTTCCTCGAGGAAACAACACCAATGAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183087.4-1483s21c1
Sequence:CCGGATCCACTGGTGACCCAGATACCTCGAGGTATCTGGGTCACCAGTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183087.4-907s21c1
Sequence:CCGGTCTGGACTTTGATGAGTTTATCTCGAGATAAACTCATCAAAGTCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183087.4-2554s21c1
Sequence:CCGGTGTATCTGACCTCACCTAATTCTCGAGAATTAGGTGAGGTCAGATACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015307
FAM189A1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 189, member A1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015307.1-547s21c1
Sequence:CCGGCTCAACGTCCTGTCCACTATCCTCGAGGATAGTGGACAGGACGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015307.1-1614s21c1
Sequence:CCGGGGTATGAAGGAGCCACATTTCCTCGAGGAAATGTGGCTCCTTCATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015307.1-303s21c1
Sequence:CCGGAGTGTGTGTAATGCTGAATTTCTCGAGAAATTCAGCATTACACACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015307.1-2089s21c1
Sequence:CCGGGGCTCGATGGCTCTATCATTACTCGAGTAATGATAGAGCCATCGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015307.1-371s21c1
Sequence:CCGGTAGAAGGCTGCCAGTTGATTACTCGAGTAATCAACTGGCAGCCTTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015307
FAM189A1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 189, member A1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015307.1-547s21c1
Sequence:CCGGCTCAACGTCCTGTCCACTATCCTCGAGGATAGTGGACAGGACGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015307.1-1614s21c1
Sequence:CCGGGGTATGAAGGAGCCACATTTCCTCGAGGAAATGTGGCTCCTTCATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015307.1-303s21c1
Sequence:CCGGAGTGTGTGTAATGCTGAATTTCTCGAGAAATTCAGCATTACACACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015307.1-2089s21c1
Sequence:CCGGGGCTCGATGGCTCTATCATTACTCGAGTAATGATAGAGCCATCGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015307.1-371s21c1
Sequence:CCGGTAGAAGGCTGCCAGTTGATTACTCGAGTAATCAACTGGCAGCCTTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015307
FAM189A1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 189, member A1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015307.1-547s21c1
Sequence:CCGGCTCAACGTCCTGTCCACTATCCTCGAGGATAGTGGACAGGACGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015307.1-1614s21c1
Sequence:CCGGGGTATGAAGGAGCCACATTTCCTCGAGGAAATGTGGCTCCTTCATACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015307.1-303s21c1
Sequence:CCGGAGTGTGTGTAATGCTGAATTTCTCGAGAAATTCAGCATTACACACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015307.1-2089s21c1
Sequence:CCGGGGCTCGATGGCTCTATCATTACTCGAGTAATGATAGAGCCATCGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015307.1-371s21c1
Sequence:CCGGTAGAAGGCTGCCAGTTGATTACTCGAGTAATCAACTGGCAGCCTTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)