EMAIL THIS PAGE TO A FRIEND

FAM194B

family with sequence similarity 194, member B

56 Gene Product Result for
UniProtKB ID: Q5W0A0, Q96MB5
Gene ID:
domestic guinea pig(100735221) family with sequence similarity 194, member B
naked mole-rat(101701936) family with sequence similarity 194, member B
chicken(418847) family with sequence similarity 194, member B
domestic cat(101085093) family with sequence similarity 194, member B
dog(100683849) family with sequence similarity 194, member B
cow(100335323) family with sequence similarity 194, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182542 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182542 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182542 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001719972 Rosetta Predictions human pricing
XM_495949 Rosetta Predictions human pricing
XM_933253 Rosetta Predictions human pricing
XM_942284 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00433783 predicted 1229
2 SASI_Hs02_00433784 predicted 1333
3 SASI_Hs02_00433785 predicted 1520
4 SASI_Hs02_00433786 predicted 1706
5 SASI_Hs02_00433787 predicted 1947
6 SASI_Hs02_00433788 predicted 1509
7 SASI_Hs02_00433789 predicted 1378
8 SASI_Hs02_00433790 predicted 1534
9 SASI_Hs02_00433791 predicted 1160
10 SASI_Hs02_00433792 predicted 1718
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_495949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479938 predicted 1770
2 SASI_Hs01_00270352 predicted 1713
3 SASI_Hs01_00270353 predicted 1947
4 SASI_Hs02_00479939 predicted 1972
5 SASI_Hs02_00479940 predicted 1861
6 SASI_Hs01_00270358 predicted 1721
7 SASI_Hs02_00479941 predicted 1769
8 SASI_Hs02_00479942 predicted 1932
9 SASI_Hs02_00479943 predicted 1982
10 SASI_Hs02_00479944 predicted 1870
11 SASI_Hs01_00270349 predicted 1229
12 SASI_Hs01_00270350 predicted 1326
13 SASI_Hs01_00270351 predicted 1523
14 SASI_Hs01_00270354 predicted 1507
15 SASI_Hs01_00270355 predicted 1370
16 SASI_Hs01_00270356 predicted 1530
17 SASI_Hs01_00270357 predicted 1166
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268036 predicted 1146
2 SASI_Hs01_00268037 predicted 1254
3 SASI_Hs01_00268038 predicted 722
4 SASI_Hs01_00268039 predicted 1443
5 SASI_Hs01_00268040 predicted 1878
6 SASI_Hs01_00268041 predicted 1434
7 SASI_Hs01_00268042 predicted 1302
8 SASI_Hs01_00268043 predicted 1463
9 SASI_Hs01_00268044 predicted 1088
10 SASI_Hs01_00268045 predicted 1639
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_942284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00485347 predicted 1223
2 SASI_Hs02_00485348 predicted 1327
3 SASI_Hs02_00485349 predicted 1524
4 SASI_Hs02_00485350 predicted 1706
5 SASI_Hs02_00485351 predicted 1946
6 SASI_Hs02_00485352 predicted 1504
7 SASI_Hs02_00485353 predicted 1377
8 SASI_Hs02_00485354 predicted 1531
9 SASI_Hs02_00485355 predicted 1166
10 SASI_Hs02_00485356 predicted 1716
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182542
FAM194B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 194, member B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-1249s1c1
Sequence:CCGGGCTGCTCACAATGAACTGGAACTCGAGTTCCAGTTCATTGTGAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-1375s1c1
Sequence:CCGGCGGATTAAGAGGAGACGTGAACTCGAGTTCACGTCTCCTCTTAATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-2205s1c1
Sequence:CCGGCCTGAAGAAGATGCTCTCTAACTCGAGTTAGAGAGCATCTTCTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-274s1c1
Sequence:CCGGGAACTAGATGAGGAAAGTCTACTCGAGTAGACTTTCCTCATCTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-1978s1c1
Sequence:CCGGGAACAGAAGCAGATTTGTTTACTCGAGTAAACAAATCTGCTTCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-262s1c1
Sequence:CCGGGATACTGAAGTAGAACTAGATCTCGAGATCTAGTTCTACTTCAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-595s1c1
Sequence:CCGGGATTATATTGAGGAGGTAGATCTCGAGATCTACCTCCTCAATATAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-478s1c1
Sequence:CCGGGAGGAGGAAGAGTATATTGAACTCGAGTTCAATATACTCTTCCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-1588s1c1
Sequence:CCGGCCCAACAAGAATGTCTATCAACTCGAGTTGATAGACATTCTTGTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182542
FAM194B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 194, member B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-1249s1c1
Sequence:CCGGGCTGCTCACAATGAACTGGAACTCGAGTTCCAGTTCATTGTGAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-1375s1c1
Sequence:CCGGCGGATTAAGAGGAGACGTGAACTCGAGTTCACGTCTCCTCTTAATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-2205s1c1
Sequence:CCGGCCTGAAGAAGATGCTCTCTAACTCGAGTTAGAGAGCATCTTCTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-274s1c1
Sequence:CCGGGAACTAGATGAGGAAAGTCTACTCGAGTAGACTTTCCTCATCTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-1978s1c1
Sequence:CCGGGAACAGAAGCAGATTTGTTTACTCGAGTAAACAAATCTGCTTCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-262s1c1
Sequence:CCGGGATACTGAAGTAGAACTAGATCTCGAGATCTAGTTCTACTTCAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-595s1c1
Sequence:CCGGGATTATATTGAGGAGGTAGATCTCGAGATCTACCTCCTCAATATAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-478s1c1
Sequence:CCGGGAGGAGGAAGAGTATATTGAACTCGAGTTCAATATACTCTTCCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-1588s1c1
Sequence:CCGGCCCAACAAGAATGTCTATCAACTCGAGTTGATAGACATTCTTGTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182542
FAM194B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 194, member B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-1249s1c1
Sequence:CCGGGCTGCTCACAATGAACTGGAACTCGAGTTCCAGTTCATTGTGAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-1375s1c1
Sequence:CCGGCGGATTAAGAGGAGACGTGAACTCGAGTTCACGTCTCCTCTTAATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-2205s1c1
Sequence:CCGGCCTGAAGAAGATGCTCTCTAACTCGAGTTAGAGAGCATCTTCTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-274s1c1
Sequence:CCGGGAACTAGATGAGGAAAGTCTACTCGAGTAGACTTTCCTCATCTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-1978s1c1
Sequence:CCGGGAACAGAAGCAGATTTGTTTACTCGAGTAAACAAATCTGCTTCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-262s1c1
Sequence:CCGGGATACTGAAGTAGAACTAGATCTCGAGATCTAGTTCTACTTCAGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-595s1c1
Sequence:CCGGGATTATATTGAGGAGGTAGATCTCGAGATCTACCTCCTCAATATAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-478s1c1
Sequence:CCGGGAGGAGGAAGAGTATATTGAACTCGAGTTCAATATACTCTTCCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182542.1-1588s1c1
Sequence:CCGGCCCAACAAGAATGTCTATCAACTCGAGTTGATAGACATTCTTGTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)