EMAIL THIS PAGE TO A FRIEND

FAM207A

family with sequence similarity 207, member A

46 Gene Product Result for
Synonyms: C21orf70
UniProtKB ID: Q9NSI2
Gene ID:
Mouse(108707) family with sequence similarity 207, member A
Rat(294333) family with sequence similarity 207, member A
chicken(424042) family with sequence similarity 207, member A
cow(512069) family with sequence similarity 207, member A
domestic cat(101086998) family with sequence similarity 207, member A
dog(611610) family with sequence similarity 207, member A
sheep(101105213) family with sequence similarity 207, member A
domestic guinea pig(100717619) family with sequence similarity 207, member A
naked mole-rat(101704296) family with sequence similarity 207, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_058190 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058190 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058190 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133998 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133998 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133998 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_058190 Rosetta Predictions human pricing
NM_001008307 Rosetta Predictions rat pricing
NM_133998 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034714 predicted 567
2 SASI_Hs01_00034715 predicted 617
3 SASI_Hs01_00034716 predicted 352
4 SASI_Hs01_00034717 predicted 660
5 SASI_Hs01_00034718 predicted 553
6 SASI_Hs02_00362113 predicted 614
7 SASI_Hs01_00034719 predicted 342
8 SASI_Hs01_00034720 predicted 385
9 SASI_Hs01_00034721 predicted 545
10 SASI_Hs01_00034722 predicted 441
11 SASI_Hs01_00034723 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008307 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052868 predicted 695
2 SASI_Rn01_00052869 predicted 1043
3 SASI_Rn01_00052871 predicted 1143
4 SASI_Rn01_00052872 predicted 859
5 SASI_Rn01_00052873 predicted 215
6 SASI_Rn01_00052874 predicted 211
7 SASI_Rn01_00052875 predicted 871
8 SASI_Rn01_00052876 predicted 1140
9 SASI_Rn01_00052877 predicted 763
10 SASI_Rn02_00199027 predicted 517
11 SASI_Rn01_00052870 predicted 1026
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133998 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145876 predicted 703
2 SASI_Mm01_00145877 predicted 546
3 SASI_Mm01_00145878 predicted 227
4 SASI_Mm01_00145879 predicted 894
5 SASI_Mm01_00145880 predicted 1171
6 SASI_Mm01_00145881 predicted 268
7 SASI_Mm01_00145882 predicted 528
8 SASI_Mm01_00145883 predicted 1183
9 SASI_Mm01_00145884 predicted 713
10 SASI_Mm02_00339140 predicted 762
11 SASI_Mm01_00145885 predicted 462
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058190
VALIDATED
FAM207A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 207, member A
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_058190.2-729s1c1
Sequence:CCGGCCACAACTCCTCAGGACACATCTCGAGATGTGTCCTGAGGAGTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_058190.2-352s1c1
Sequence:CCGGCGTGAGCAATGGTTGCAGAAACTCGAGTTTCTGCAACCATTGCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_058190.2-589s1c1
Sequence:CCGGGAGGAAGAAAGGACCCGGTTTCTCGAGAAACCGGGTCCTTTCTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_058190.2-150s1c1
Sequence:CCGGCTGGGCGTTCATCAACACCAACTCGAGTTGGTGTTGATGAACGCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_058190.2-156s1c1
Sequence:CCGGGTTCATCAACACCAACATCTTCTCGAGAAGATGTTGGTGTTGATGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058190.2-235s21c1
Sequence:CCGGAGTGTCACTTCCGTCAGGAGACTCGAGTCTCCTGACGGAAGTGACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058190.2-288s21c1
Sequence:CCGGTTCCATCAGGAGAGGTGCAGACTCGAGTCTGCACCTCTCCTGATGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058190.2-212s21c1
Sequence:CCGGAGAAGCTGGAGCTGGACGTGACTCGAGTCACGTCCAGCTCCAGCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058190.2-302s21c1
Sequence:CCGGGTGCAGAGGCCAAGACCGTTTCTCGAGAAACGGTCTTGGCCTCTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058190.2-570s21c1
Sequence:CCGGCCAGAGACAGCAGCTTCTCGACTCGAGTCGAGAAGCTGCTGTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058190.2-341s21c1
Sequence:CCGGTGAAGCTGAGGCGTGAGCAATCTCGAGATTGCTCACGCCTCAGCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058190.2-744s21c1
Sequence:CCGGACACATGTGGGCCAAGTAGAGCTCGAGCTCTACTTGGCCCACATGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058190
VALIDATED
FAM207A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 207, member A
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_058190.2-729s1c1
Sequence:CCGGCCACAACTCCTCAGGACACATCTCGAGATGTGTCCTGAGGAGTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_058190.2-352s1c1
Sequence:CCGGCGTGAGCAATGGTTGCAGAAACTCGAGTTTCTGCAACCATTGCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_058190.2-589s1c1
Sequence:CCGGGAGGAAGAAAGGACCCGGTTTCTCGAGAAACCGGGTCCTTTCTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_058190.2-150s1c1
Sequence:CCGGCTGGGCGTTCATCAACACCAACTCGAGTTGGTGTTGATGAACGCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_058190.2-156s1c1
Sequence:CCGGGTTCATCAACACCAACATCTTCTCGAGAAGATGTTGGTGTTGATGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058190.2-235s21c1
Sequence:CCGGAGTGTCACTTCCGTCAGGAGACTCGAGTCTCCTGACGGAAGTGACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058190.2-288s21c1
Sequence:CCGGTTCCATCAGGAGAGGTGCAGACTCGAGTCTGCACCTCTCCTGATGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058190.2-212s21c1
Sequence:CCGGAGAAGCTGGAGCTGGACGTGACTCGAGTCACGTCCAGCTCCAGCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058190.2-302s21c1
Sequence:CCGGGTGCAGAGGCCAAGACCGTTTCTCGAGAAACGGTCTTGGCCTCTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058190.2-570s21c1
Sequence:CCGGCCAGAGACAGCAGCTTCTCGACTCGAGTCGAGAAGCTGCTGTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058190.2-341s21c1
Sequence:CCGGTGAAGCTGAGGCGTGAGCAATCTCGAGATTGCTCACGCCTCAGCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058190.2-744s21c1
Sequence:CCGGACACATGTGGGCCAAGTAGAGCTCGAGCTCTACTTGGCCCACATGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058190
VALIDATED
FAM207A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 207, member A
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_058190.2-729s1c1
Sequence:CCGGCCACAACTCCTCAGGACACATCTCGAGATGTGTCCTGAGGAGTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_058190.2-352s1c1
Sequence:CCGGCGTGAGCAATGGTTGCAGAAACTCGAGTTTCTGCAACCATTGCTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_058190.2-589s1c1
Sequence:CCGGGAGGAAGAAAGGACCCGGTTTCTCGAGAAACCGGGTCCTTTCTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_058190.2-150s1c1
Sequence:CCGGCTGGGCGTTCATCAACACCAACTCGAGTTGGTGTTGATGAACGCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_058190.2-156s1c1
Sequence:CCGGGTTCATCAACACCAACATCTTCTCGAGAAGATGTTGGTGTTGATGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058190.2-235s21c1
Sequence:CCGGAGTGTCACTTCCGTCAGGAGACTCGAGTCTCCTGACGGAAGTGACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058190.2-288s21c1
Sequence:CCGGTTCCATCAGGAGAGGTGCAGACTCGAGTCTGCACCTCTCCTGATGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058190.2-212s21c1
Sequence:CCGGAGAAGCTGGAGCTGGACGTGACTCGAGTCACGTCCAGCTCCAGCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058190.2-302s21c1
Sequence:CCGGGTGCAGAGGCCAAGACCGTTTCTCGAGAAACGGTCTTGGCCTCTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058190.2-570s21c1
Sequence:CCGGCCAGAGACAGCAGCTTCTCGACTCGAGTCGAGAAGCTGCTGTCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058190.2-341s21c1
Sequence:CCGGTGAAGCTGAGGCGTGAGCAATCTCGAGATTGCTCACGCCTCAGCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058190.2-744s21c1
Sequence:CCGGACACATGTGGGCCAAGTAGAGCTCGAGCTCTACTTGGCCCACATGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133998
VALIDATED
FAM207A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 207, member A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133998.1-1805s1c1
Sequence:CCGGGCTCTCATTAAGAGAGCCTAACTCGAGTTAGGCTCTCTTAATGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133998.1-185s1c1
Sequence:CCGGGACTGGACATTCGTTCACAATCTCGAGATTGTGAACGAATGTCCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133998.1-344s1c1
Sequence:CCGGCGTGAGCGATGGTTACAGAAACTCGAGTTTCTGTAACCATCGCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133998.1-545s1c1
Sequence:CCGGCTCAGCCGAATGACCACAGTACTCGAGTACTGTGGTCATTCGGCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133998.1-583s1c1
Sequence:CCGGTGAAGAAGAAAGGACCCGGTTCTCGAGAACCGGGTCCTTTCTTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133998.3-610s21c1
Sequence:CCGGTGAAGAAGAAAGGACCCGGTTCTCGAGAACCGGGTCCTTTCTTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133998.3-321s21c1
Sequence:CCGGGTGCAGAGCCAAAGGCCATTTCTCGAGAAATGGCCTTTGGCTCTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133998.3-864s21c1
Sequence:CCGGCTGCCGGTGAGGACAAATAAACTCGAGTTTATTTGTCCTCACCGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133998.3-212s21c1
Sequence:CCGGGACTGGACATTCGTTCACAATCTCGAGATTGTGAACGAATGTCCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133998.3-371s21c1
Sequence:CCGGCGTGAGCGATGGTTACAGAAACTCGAGTTTCTGTAACCATCGCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133998
VALIDATED
FAM207A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 207, member A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133998.1-1805s1c1
Sequence:CCGGGCTCTCATTAAGAGAGCCTAACTCGAGTTAGGCTCTCTTAATGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133998.1-185s1c1
Sequence:CCGGGACTGGACATTCGTTCACAATCTCGAGATTGTGAACGAATGTCCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133998.1-344s1c1
Sequence:CCGGCGTGAGCGATGGTTACAGAAACTCGAGTTTCTGTAACCATCGCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133998.1-545s1c1
Sequence:CCGGCTCAGCCGAATGACCACAGTACTCGAGTACTGTGGTCATTCGGCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133998.1-583s1c1
Sequence:CCGGTGAAGAAGAAAGGACCCGGTTCTCGAGAACCGGGTCCTTTCTTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133998.3-610s21c1
Sequence:CCGGTGAAGAAGAAAGGACCCGGTTCTCGAGAACCGGGTCCTTTCTTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133998.3-321s21c1
Sequence:CCGGGTGCAGAGCCAAAGGCCATTTCTCGAGAAATGGCCTTTGGCTCTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133998.3-864s21c1
Sequence:CCGGCTGCCGGTGAGGACAAATAAACTCGAGTTTATTTGTCCTCACCGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133998.3-212s21c1
Sequence:CCGGGACTGGACATTCGTTCACAATCTCGAGATTGTGAACGAATGTCCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133998.3-371s21c1
Sequence:CCGGCGTGAGCGATGGTTACAGAAACTCGAGTTTCTGTAACCATCGCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133998
VALIDATED
FAM207A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 207, member A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133998.1-1805s1c1
Sequence:CCGGGCTCTCATTAAGAGAGCCTAACTCGAGTTAGGCTCTCTTAATGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133998.1-185s1c1
Sequence:CCGGGACTGGACATTCGTTCACAATCTCGAGATTGTGAACGAATGTCCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133998.1-344s1c1
Sequence:CCGGCGTGAGCGATGGTTACAGAAACTCGAGTTTCTGTAACCATCGCTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133998.1-545s1c1
Sequence:CCGGCTCAGCCGAATGACCACAGTACTCGAGTACTGTGGTCATTCGGCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133998.1-583s1c1
Sequence:CCGGTGAAGAAGAAAGGACCCGGTTCTCGAGAACCGGGTCCTTTCTTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133998.3-610s21c1
Sequence:CCGGTGAAGAAGAAAGGACCCGGTTCTCGAGAACCGGGTCCTTTCTTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133998.3-321s21c1
Sequence:CCGGGTGCAGAGCCAAAGGCCATTTCTCGAGAAATGGCCTTTGGCTCTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133998.3-864s21c1
Sequence:CCGGCTGCCGGTGAGGACAAATAAACTCGAGTTTATTTGTCCTCACCGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133998.3-212s21c1
Sequence:CCGGGACTGGACATTCGTTCACAATCTCGAGATTGTGAACGAATGTCCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133998.3-371s21c1
Sequence:CCGGCGTGAGCGATGGTTACAGAAACTCGAGTTTCTGTAACCATCGCTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)