EMAIL THIS PAGE TO A FRIEND

FAM210B

family with sequence similarity 210, member B

59 Gene Product Result for
Synonyms: 5A3 C20orf108 dJ1167H4.1
UniProtKB ID: Q96KR6, B2RBQ9, E1P5Y7, Q8WVN2, Q9BYL6, Q9H418
Gene ID:
Mouse(67017) family with sequence similarity 210, member B
Rat(296408) family with sequence similarity 210, member B
domestic cat(101095163) family with sequence similarity 210, member B
cow(516545) family with sequence similarity 210, member B
dog(485939) family with sequence similarity 210, member B
naked mole-rat(101712313) family with sequence similarity 210, member B
domestic guinea pig(100726908) family with sequence similarity 210, member B
sheep(101105431) family with sequence similarity 210, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA042652 Anti-FAM210B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080821 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080821 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080821 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025912 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025912 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025912 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080821 Rosetta Predictions human pricing
NM_001106547 Rosetta Predictions rat pricing
NM_025912 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134260 predicted 785
2 SASI_Hs01_00134262 predicted 852
3 SASI_Hs01_00134263 predicted 463
4 SASI_Hs01_00134264 predicted 907
5 SASI_Hs01_00134265 predicted 544
6 SASI_Hs01_00134266 predicted 512
7 SASI_Hs01_00134267 predicted 1151
8 SASI_Hs01_00134269 predicted 1115
9 SASI_Hs02_00362596 predicted 543
10 SASI_Hs02_00362597 predicted 559
11 SASI_Hs01_00134261 predicted 911
12 SASI_Hs01_00134268 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106547 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220028 predicted 425
2 SASI_Rn02_00220029 predicted 396
3 SASI_Rn02_00220030 predicted 420
4 SASI_Rn02_00220031 predicted 401
5 SASI_Rn02_00220032 predicted 391
6 SASI_Rn02_00220033 predicted 366
7 SASI_Rn02_00220034 predicted 332
8 SASI_Rn02_00220035 predicted 1095
9 SASI_Rn02_00220036 predicted 705
10 SASI_Rn02_00220037 predicted 1073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025912 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087116 predicted 389
2 SASI_Mm01_00087118 predicted 1005
3 SASI_Mm01_00087119 predicted 615
4 SASI_Mm01_00087120 predicted 1082
5 SASI_Mm01_00087121 predicted 428
6 SASI_Mm01_00087122 predicted 627
7 SASI_Mm01_00087123 predicted 938
8 SASI_Mm01_00087124 predicted 502
9 SASI_Mm01_00087125 predicted 1044
10 SASI_Mm02_00329269 predicted 559
11 SASI_Mm01_00087117 predicted 1130
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080821
VALIDATED
FAM210B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 210, member B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080821.2-384s21c1
Sequence:CCGGCATTGCACATTGGAATCTCATCTCGAGATGAGATTCCAATGTGCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080821.2-464s21c1
Sequence:CCGGCTGCTGAAACTCGGATTTAAACTCGAGTTTAAATCCGAGTTTCAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080821.2-400s21c1
Sequence:CCGGCTCATTAATTTCCTTGGGCATCTCGAGATGCCCAAGGAAATTAATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080821.2-595s21c1
Sequence:CCGGGCCCTTGATTGTCAGATATTTCTCGAGAAATATCTGACAATCAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080821.1-345s1c1
Sequence:CCGGCATTGCACATTGGAATCTCATCTCGAGATGAGATTCCAATGTGCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080821.1-556s1c1
Sequence:CCGGGCCCTTGATTGTCAGATATTTCTCGAGAAATATCTGACAATCAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080821.1-425s1c1
Sequence:CCGGCTGCTGAAACTCGGATTTAAACTCGAGTTTAAATCCGAGTTTCAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_080821.1-361s1c1
Sequence:CCGGCTCATTAATTTCCTTGGGCATCTCGAGATGCCCAAGGAAATTAATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080821
VALIDATED
FAM210B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 210, member B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080821.2-384s21c1
Sequence:CCGGCATTGCACATTGGAATCTCATCTCGAGATGAGATTCCAATGTGCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080821.2-464s21c1
Sequence:CCGGCTGCTGAAACTCGGATTTAAACTCGAGTTTAAATCCGAGTTTCAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080821.2-400s21c1
Sequence:CCGGCTCATTAATTTCCTTGGGCATCTCGAGATGCCCAAGGAAATTAATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080821.2-595s21c1
Sequence:CCGGGCCCTTGATTGTCAGATATTTCTCGAGAAATATCTGACAATCAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080821.1-345s1c1
Sequence:CCGGCATTGCACATTGGAATCTCATCTCGAGATGAGATTCCAATGTGCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080821.1-556s1c1
Sequence:CCGGGCCCTTGATTGTCAGATATTTCTCGAGAAATATCTGACAATCAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080821.1-425s1c1
Sequence:CCGGCTGCTGAAACTCGGATTTAAACTCGAGTTTAAATCCGAGTTTCAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_080821.1-361s1c1
Sequence:CCGGCTCATTAATTTCCTTGGGCATCTCGAGATGCCCAAGGAAATTAATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080821
VALIDATED
FAM210B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 210, member B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080821.2-384s21c1
Sequence:CCGGCATTGCACATTGGAATCTCATCTCGAGATGAGATTCCAATGTGCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080821.2-464s21c1
Sequence:CCGGCTGCTGAAACTCGGATTTAAACTCGAGTTTAAATCCGAGTTTCAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080821.2-400s21c1
Sequence:CCGGCTCATTAATTTCCTTGGGCATCTCGAGATGCCCAAGGAAATTAATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080821.2-595s21c1
Sequence:CCGGGCCCTTGATTGTCAGATATTTCTCGAGAAATATCTGACAATCAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080821.1-345s1c1
Sequence:CCGGCATTGCACATTGGAATCTCATCTCGAGATGAGATTCCAATGTGCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080821.1-556s1c1
Sequence:CCGGGCCCTTGATTGTCAGATATTTCTCGAGAAATATCTGACAATCAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080821.1-425s1c1
Sequence:CCGGCTGCTGAAACTCGGATTTAAACTCGAGTTTAAATCCGAGTTTCAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_080821.1-361s1c1
Sequence:CCGGCTCATTAATTTCCTTGGGCATCTCGAGATGCCCAAGGAAATTAATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025912
VALIDATED
FAM210B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 210, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025912.2-1871s1c1
Sequence:CCGGGCTGCTTTCTTATAGAACATACTCGAGTATGTTCTATAAGAAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025912.2-428s1c1
Sequence:CCGGTCTGCAATCCTGCTTAAACTTCTCGAGAAGTTTAAGCAGGATTGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025912.2-521s1c1
Sequence:CCGGCATAAGCTGTTTGCTCCCGTTCTCGAGAACGGGAGCAAACAGCTTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025912.2-538s1c1
Sequence:CCGGCGTTCGGATCAGCATCACCTTCTCGAGAAGGTGATGCTGATCCGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025912.2-424s1c1
Sequence:CCGGCATGTCTGCAATCCTGCTTAACTCGAGTTAAGCAGGATTGCAGACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025912
VALIDATED
FAM210B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 210, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025912.2-1871s1c1
Sequence:CCGGGCTGCTTTCTTATAGAACATACTCGAGTATGTTCTATAAGAAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025912.2-428s1c1
Sequence:CCGGTCTGCAATCCTGCTTAAACTTCTCGAGAAGTTTAAGCAGGATTGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025912.2-521s1c1
Sequence:CCGGCATAAGCTGTTTGCTCCCGTTCTCGAGAACGGGAGCAAACAGCTTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025912.2-538s1c1
Sequence:CCGGCGTTCGGATCAGCATCACCTTCTCGAGAAGGTGATGCTGATCCGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025912.2-424s1c1
Sequence:CCGGCATGTCTGCAATCCTGCTTAACTCGAGTTAAGCAGGATTGCAGACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025912
VALIDATED
FAM210B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 210, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025912.2-1871s1c1
Sequence:CCGGGCTGCTTTCTTATAGAACATACTCGAGTATGTTCTATAAGAAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025912.2-428s1c1
Sequence:CCGGTCTGCAATCCTGCTTAAACTTCTCGAGAAGTTTAAGCAGGATTGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025912.2-521s1c1
Sequence:CCGGCATAAGCTGTTTGCTCCCGTTCTCGAGAACGGGAGCAAACAGCTTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025912.2-538s1c1
Sequence:CCGGCGTTCGGATCAGCATCACCTTCTCGAGAAGGTGATGCTGATCCGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025912.2-424s1c1
Sequence:CCGGCATGTCTGCAATCCTGCTTAACTCGAGTTAAGCAGGATTGCAGACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)