EMAIL THIS PAGE TO A FRIEND

FAM21A

family with sequence similarity 21, member A

17 Gene Product Result for
Synonyms: bA56A21.1
UniProtKB ID: Q641Q2, A2A3S2, A2A3U6, Q6DHY0
Gene ID:
domestic guinea pig(100718656) family with sequence similarity 21, member A
chicken(423772) family with sequence similarity 21, member A
domestic cat(101096765) family with sequence similarity 21, member A
cow(513740) family with sequence similarity 21, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005751 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005751 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005751 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005751 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093378 predicted 3160
2 SASI_Hs01_00093379 predicted 2450
3 SASI_Hs01_00093380 predicted 2244
4 SASI_Hs01_00093381 predicted 3589
5 SASI_Hs01_00093382 predicted 363
6 SASI_Hs01_00093383 predicted 2683
7 SASI_Hs01_00093384 predicted 267
8 SASI_Hs02_00305024 predicted 2888
9 SASI_Hs01_00093385 predicted 2865
10 SASI_Hs01_00093386 predicted 3967
11 SASI_Hs01_00093387 predicted 1991
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005751
VALIDATED
FAM21A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 21, member A
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001005751.1-2923s1c1
Sequence:CCGGCAAAGAACCATCCACTCGGATCTCGAGATCCGAGTGGATGGTTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005751.1-785s1c1
Sequence:CCGGGCCCATCATAGTGACAATGAACTCGAGTTCATTGTCACTATGATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001005751.1-4174s1c1
Sequence:CCGGGCTGATGGTCTTAACTGGATTCTCGAGAATCCAGTTAAGACCATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001005751.1-3941s1c1
Sequence:CCGGGCCAAGTCTATATTTGATGATCTCGAGATCATCAAATATAGACTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001005751.1-2844s1c1
Sequence:CCGGCCATTCAAGGTAGTAAAGAAACTCGAGTTTCTTTACTACCTTGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005751.1-347s1c1
Sequence:CCGGCTCTCTAATACCCAGTTCATTCTCGAGAATGAACTGGGTATTAGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001005751.1-2941s1c1
Sequence:CCGGGATCGGGAAGATACAAGCAAACTCGAGTTTGCTTGTATCTTCCCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001005751.1-488s1c1
Sequence:CCGGGCTGTGAACTATGGCTTACAACTCGAGTTGTAAGCCATAGTTCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001005751.1-4446s1c1
Sequence:CCGGCCTGACCAGAAGTCTTTGTTACTCGAGTAACAAAGACTTCTGGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005751.1-488s21c1
Sequence:CCGGGCTGTGAACTATGGCTTACAACTCGAGTTGTAAGCCATAGTTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005751.1-2941s21c1
Sequence:CCGGGATCGGGAAGATACAAGCAAACTCGAGTTTGCTTGTATCTTCCCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005751.1-2844s21c1
Sequence:CCGGCCATTCAAGGTAGTAAAGAAACTCGAGTTTCTTTACTACCTTGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005751.1-3941s21c1
Sequence:CCGGGCCAAGTCTATATTTGATGATCTCGAGATCATCAAATATAGACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005751
VALIDATED
FAM21A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 21, member A
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001005751.1-2923s1c1
Sequence:CCGGCAAAGAACCATCCACTCGGATCTCGAGATCCGAGTGGATGGTTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005751.1-785s1c1
Sequence:CCGGGCCCATCATAGTGACAATGAACTCGAGTTCATTGTCACTATGATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001005751.1-4174s1c1
Sequence:CCGGGCTGATGGTCTTAACTGGATTCTCGAGAATCCAGTTAAGACCATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001005751.1-3941s1c1
Sequence:CCGGGCCAAGTCTATATTTGATGATCTCGAGATCATCAAATATAGACTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001005751.1-2844s1c1
Sequence:CCGGCCATTCAAGGTAGTAAAGAAACTCGAGTTTCTTTACTACCTTGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005751.1-347s1c1
Sequence:CCGGCTCTCTAATACCCAGTTCATTCTCGAGAATGAACTGGGTATTAGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001005751.1-2941s1c1
Sequence:CCGGGATCGGGAAGATACAAGCAAACTCGAGTTTGCTTGTATCTTCCCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001005751.1-488s1c1
Sequence:CCGGGCTGTGAACTATGGCTTACAACTCGAGTTGTAAGCCATAGTTCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001005751.1-4446s1c1
Sequence:CCGGCCTGACCAGAAGTCTTTGTTACTCGAGTAACAAAGACTTCTGGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005751.1-488s21c1
Sequence:CCGGGCTGTGAACTATGGCTTACAACTCGAGTTGTAAGCCATAGTTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005751.1-2941s21c1
Sequence:CCGGGATCGGGAAGATACAAGCAAACTCGAGTTTGCTTGTATCTTCCCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005751.1-2844s21c1
Sequence:CCGGCCATTCAAGGTAGTAAAGAAACTCGAGTTTCTTTACTACCTTGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005751.1-3941s21c1
Sequence:CCGGGCCAAGTCTATATTTGATGATCTCGAGATCATCAAATATAGACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005751
VALIDATED
FAM21A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 21, member A
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001005751.1-2923s1c1
Sequence:CCGGCAAAGAACCATCCACTCGGATCTCGAGATCCGAGTGGATGGTTCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005751.1-785s1c1
Sequence:CCGGGCCCATCATAGTGACAATGAACTCGAGTTCATTGTCACTATGATGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001005751.1-4174s1c1
Sequence:CCGGGCTGATGGTCTTAACTGGATTCTCGAGAATCCAGTTAAGACCATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001005751.1-3941s1c1
Sequence:CCGGGCCAAGTCTATATTTGATGATCTCGAGATCATCAAATATAGACTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001005751.1-2844s1c1
Sequence:CCGGCCATTCAAGGTAGTAAAGAAACTCGAGTTTCTTTACTACCTTGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005751.1-347s1c1
Sequence:CCGGCTCTCTAATACCCAGTTCATTCTCGAGAATGAACTGGGTATTAGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001005751.1-2941s1c1
Sequence:CCGGGATCGGGAAGATACAAGCAAACTCGAGTTTGCTTGTATCTTCCCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001005751.1-488s1c1
Sequence:CCGGGCTGTGAACTATGGCTTACAACTCGAGTTGTAAGCCATAGTTCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001005751.1-4446s1c1
Sequence:CCGGCCTGACCAGAAGTCTTTGTTACTCGAGTAACAAAGACTTCTGGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005751.1-488s21c1
Sequence:CCGGGCTGTGAACTATGGCTTACAACTCGAGTTGTAAGCCATAGTTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005751.1-2941s21c1
Sequence:CCGGGATCGGGAAGATACAAGCAAACTCGAGTTTGCTTGTATCTTCCCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005751.1-2844s21c1
Sequence:CCGGCCATTCAAGGTAGTAAAGAAACTCGAGTTTCTTTACTACCTTGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005751.1-3941s21c1
Sequence:CCGGGCCAAGTCTATATTTGATGATCTCGAGATCATCAAATATAGACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)