EMAIL THIS PAGE TO A FRIEND

FAM222A

family with sequence similarity 222, member A

65 Gene Product Result for
Synonyms: C12orf34
UniProtKB ID: Q5U5X8, Q8NCD5, Q96SP6
Gene ID:
Mouse(433940) family with sequence similarity 222, member A
Rat(498193) family with sequence similarity 222, member A
Zebrafish(793922) family with sequence similarity 222, member A
domestic cat(101093304) family with sequence similarity 222, member A
naked mole-rat(101707077) family with sequence similarity 222, member A
domestic guinea pig(100723862) family with sequence similarity 222, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA040181 Anti-FAM222A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032829 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032829 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032829 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001004180 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004180 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004180 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032829 Rosetta Predictions human pricing
NM_001109067 Rosetta Predictions rat pricing
NM_001004180 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032829 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225404 predicted 1496
2 SASI_Hs01_00225405 predicted 887
3 SASI_Hs01_00225406 predicted 1180
4 SASI_Hs01_00225407 predicted 1768
5 SASI_Hs01_00225408 predicted 1378
6 SASI_Hs01_00225409 predicted 383
7 SASI_Hs01_00225410 predicted 322
8 SASI_Hs01_00225411 predicted 995
9 SASI_Hs01_00225412 predicted 290
10 SASI_Hs01_00225413 predicted 1883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109067 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244800 predicted 1034
2 SASI_Rn02_00244801 predicted 1254
3 SASI_Rn02_00244802 predicted 1512
4 SASI_Rn02_00244803 predicted 1460
5 SASI_Rn02_00244804 predicted 690
6 SASI_Rn02_00244805 predicted 1382
7 SASI_Rn02_00244806 predicted 857
8 SASI_Rn02_00244807 predicted 1270
9 SASI_Rn02_00244808 predicted 1484
10 SASI_Rn02_00244809 predicted 1577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004180 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052272 predicted 1483
2 SASI_Mm01_00052273 predicted 1492
3 SASI_Mm01_00052274 predicted 1374
4 SASI_Mm01_00052275 predicted 1560
5 SASI_Mm01_00052276 predicted 511
6 SASI_Mm01_00052278 predicted 302
7 SASI_Mm02_00286507 predicted 800
8 SASI_Mm01_00052279 predicted 461
9 SASI_Mm01_00052280 predicted 1444
10 SASI_Mm01_00052281 predicted 253
11 SASI_Mm01_00052277 predicted 1722
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032829
FAM222A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 222, member A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032829.1-1505s21c1
Sequence:CCGGCGCCTACCCGTCTACAGATAACTCGAGTTATCTGTAGACGGGTAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032829.1-335s21c1
Sequence:CCGGCCGCTGTCCATCAAGATCTTCCTCGAGGAAGATCTTGATGGACAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032829.1-2159s21c1
Sequence:CCGGCAAACCCTGGACTACCATATTCTCGAGAATATGGTAGTCCAGGGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032829.1-1182s21c1
Sequence:CCGGTCACCGTAGGCCAGTACTTTGCTCGAGCAAAGTACTGGCCTACGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032829.1-1384s21c1
Sequence:CCGGGCAGTCACTGGAGTATCTCATCTCGAGATGAGATACTCCAGTGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172488    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032829.1-2044s1c1
Sequence:CCGGCAGGTGAAGACCACTCTGATACTCGAGTATCAGAGTGGTCTTCACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032829
FAM222A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 222, member A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032829.1-1505s21c1
Sequence:CCGGCGCCTACCCGTCTACAGATAACTCGAGTTATCTGTAGACGGGTAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032829.1-335s21c1
Sequence:CCGGCCGCTGTCCATCAAGATCTTCCTCGAGGAAGATCTTGATGGACAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032829.1-2159s21c1
Sequence:CCGGCAAACCCTGGACTACCATATTCTCGAGAATATGGTAGTCCAGGGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032829.1-1182s21c1
Sequence:CCGGTCACCGTAGGCCAGTACTTTGCTCGAGCAAAGTACTGGCCTACGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032829.1-1384s21c1
Sequence:CCGGGCAGTCACTGGAGTATCTCATCTCGAGATGAGATACTCCAGTGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172488    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032829.1-2044s1c1
Sequence:CCGGCAGGTGAAGACCACTCTGATACTCGAGTATCAGAGTGGTCTTCACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032829
FAM222A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 222, member A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032829.1-1505s21c1
Sequence:CCGGCGCCTACCCGTCTACAGATAACTCGAGTTATCTGTAGACGGGTAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032829.1-335s21c1
Sequence:CCGGCCGCTGTCCATCAAGATCTTCCTCGAGGAAGATCTTGATGGACAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032829.1-2159s21c1
Sequence:CCGGCAAACCCTGGACTACCATATTCTCGAGAATATGGTAGTCCAGGGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032829.1-1182s21c1
Sequence:CCGGTCACCGTAGGCCAGTACTTTGCTCGAGCAAAGTACTGGCCTACGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032829.1-1384s21c1
Sequence:CCGGGCAGTCACTGGAGTATCTCATCTCGAGATGAGATACTCCAGTGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172488    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032829.1-2044s1c1
Sequence:CCGGCAGGTGAAGACCACTCTGATACTCGAGTATCAGAGTGGTCTTCACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004180
FAM222A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 222, member A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004180.1-1450s1c1
Sequence:CCGGGAGTATCTCATCAACGACATCCTCGAGGATGTCGTTGATGAGATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004180.1-1477s1c1
Sequence:CCGGCCCTGCATCAAAGAACAGATGCTCGAGCATCTGTTCTTTGATGCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198426    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004180.1-2567s1c1
Sequence:CCGGGCATTTACAAAGCTCTGAGAACTCGAGTTCTCAGAGCTTTGTAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004180.1-1265s1c1
Sequence:CCGGCTTGGAACAGTGTTCTGGTGACTCGAGTCACCAGAACACTGTTCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004180.1-797s1c1
Sequence:CCGGCCAACCTACCCTCTATCCATACTCGAGTATGGATAGAGGGTAGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004180.1-801s1c1
Sequence:CCGGCCTACCCTCTATCCATAGCATCTCGAGATGCTATGGATAGAGGGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004180.1-1395s1c1
Sequence:CCGGGACCAGCAAGAGTGTGTGTAACTCGAGTTACACACACTCTTGCTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004180.1-1485s1c1
Sequence:CCGGCAAAGAACAGATGCTGGGTAACTCGAGTTACCCAGCATCTGTTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004180
FAM222A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 222, member A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004180.1-1450s1c1
Sequence:CCGGGAGTATCTCATCAACGACATCCTCGAGGATGTCGTTGATGAGATACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004180.1-1477s1c1
Sequence:CCGGCCCTGCATCAAAGAACAGATGCTCGAGCATCTGTTCTTTGATGCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198426    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004180.1-2567s1c1
Sequence:CCGGGCATTTACAAAGCTCTGAGAACTCGAGTTCTCAGAGCTTTGTAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004180.1-1265s1c1
Sequence:CCGGCTTGGAACAGTGTTCTGGTGACTCGAGTCACCAGAACACTGTTCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004180.1-797s1c1
Sequence:CCGGCCAACCTACCCTCTATCCATACTCGAGTATGGATAGAGGGTAGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004180.1-801s1c1
Sequence:CCGGCCTACCCTCTATCCATAGCATCTCGAGATGCTATGGATAGAGGGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004180.1-1395s1c1
Sequence:CCGGGACCAGCAAGAGTGTGTGTAACTCGAGTTACACACACTCTTGCTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004180.1-1485s1c1
Sequence:CCGGCAAAGAACAGATGCTGGGTAACTCGAGTTACCCAGCATCTGTTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004180
FAM222A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 222, member A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004180.1-1450s1c1
Sequence:CCGGGAGTATCTCATCAACGACATCCTCGAGGATGTCGTTGATGAGATACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004180.1-1477s1c1
Sequence:CCGGCCCTGCATCAAAGAACAGATGCTCGAGCATCTGTTCTTTGATGCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198426    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004180.1-2567s1c1
Sequence:CCGGGCATTTACAAAGCTCTGAGAACTCGAGTTCTCAGAGCTTTGTAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004180.1-1265s1c1
Sequence:CCGGCTTGGAACAGTGTTCTGGTGACTCGAGTCACCAGAACACTGTTCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004180.1-797s1c1
Sequence:CCGGCCAACCTACCCTCTATCCATACTCGAGTATGGATAGAGGGTAGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004180.1-801s1c1
Sequence:CCGGCCTACCCTCTATCCATAGCATCTCGAGATGCTATGGATAGAGGGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004180.1-1395s1c1
Sequence:CCGGGACCAGCAAGAGTGTGTGTAACTCGAGTTACACACACTCTTGCTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004180.1-1485s1c1
Sequence:CCGGCAAAGAACAGATGCTGGGTAACTCGAGTTACCCAGCATCTGTTCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)