EMAIL THIS PAGE TO A FRIEND

FAM3D

family with sequence similarity 3, member D

34 Gene Product Result for
Synonyms: EF7 OIT1
UniProtKB ID: Q96BQ1, Q547G2
Gene ID:
Rat(289949) family with sequence similarity 3, member D
chicken(416069) family with sequence similarity 3, member D
cow(514459) family with sequence similarity 3, member D
domestic cat(101082219) family with sequence similarity 3, member D
dog(607366) family with sequence similarity 3, member D
domestic guinea pig(100734778) family with sequence similarity 3, member D
naked mole-rat(101718087) family with sequence similarity 3, member D
sheep(101108169) family with sequence similarity 3, member D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138805 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138805 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138805 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143201 MISSION® esiRNA esiRNA human FAM3D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138805 Rosetta Predictions human pricing
NM_001106027 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138805 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031718 predicted 478
2 SASI_Hs01_00031719 predicted 549
3 SASI_Hs01_00031720 predicted 342
4 SASI_Hs01_00031721 predicted 828
5 SASI_Hs01_00031722 predicted 663
6 SASI_Hs01_00031723 predicted 591
7 SASI_Hs01_00031724 predicted 351
8 SASI_Hs01_00031725 predicted 669
9 SASI_Hs01_00031726 predicted 347
10 SASI_Hs01_00031727 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106027 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214902 predicted 865
2 SASI_Rn02_00214903 predicted 1008
3 SASI_Rn02_00214904 predicted 828
4 SASI_Rn02_00214905 predicted 561
5 SASI_Rn02_00214906 predicted 915
6 SASI_Rn02_00214907 predicted 457
7 SASI_Rn02_00214908 predicted 677
8 SASI_Rn02_00214909 predicted 1000
9 SASI_Rn02_00214910 predicted 834
10 SASI_Rn02_00214911 predicted 983
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138805
FAM3D MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 3, member D
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138805.2-657s21c1
Sequence:CCGGCATGTACTCTGGAGATGTTATCTCGAGATAACATCTCCAGAGTACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138805.2-330s21c1
Sequence:CCGGCCTCATCTTTGCCATAGTCACCTCGAGGTGACTATGGCAAAGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138805.2-582s21c1
Sequence:CCGGCAATGTGGGCAGAGGCCTAAACTCGAGTTTAGGCCTCTGCCCACATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138805.2-481s1c1
Sequence:CCGGCCAGCCAACTACTTTGCGTTTCTCGAGAAACGCAAAGTAGTTGGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138805.2-543s1c1
Sequence:CCGGGTGCTTTGAAGACCGCATGATCTCGAGATCATGCGGTCTTCAAAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138805.2-357s1c1
Sequence:CCGGGATGTTTATTCGAAGCTACATCTCGAGATGTAGCTTCGAATAAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138805.2-679s1c1
Sequence:CCGGCACCTAGTGAAATTCCTTAAACTCGAGTTTAAGGAATTTCACTAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138805.2-771s1c1
Sequence:CCGGCAGGAAACTCTTCTCTGACTTCTCGAGAAGTCAGAGAAGAGTTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138805
FAM3D MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 3, member D
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138805.2-657s21c1
Sequence:CCGGCATGTACTCTGGAGATGTTATCTCGAGATAACATCTCCAGAGTACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138805.2-330s21c1
Sequence:CCGGCCTCATCTTTGCCATAGTCACCTCGAGGTGACTATGGCAAAGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138805.2-582s21c1
Sequence:CCGGCAATGTGGGCAGAGGCCTAAACTCGAGTTTAGGCCTCTGCCCACATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138805.2-481s1c1
Sequence:CCGGCCAGCCAACTACTTTGCGTTTCTCGAGAAACGCAAAGTAGTTGGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138805.2-543s1c1
Sequence:CCGGGTGCTTTGAAGACCGCATGATCTCGAGATCATGCGGTCTTCAAAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138805.2-357s1c1
Sequence:CCGGGATGTTTATTCGAAGCTACATCTCGAGATGTAGCTTCGAATAAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138805.2-679s1c1
Sequence:CCGGCACCTAGTGAAATTCCTTAAACTCGAGTTTAAGGAATTTCACTAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138805.2-771s1c1
Sequence:CCGGCAGGAAACTCTTCTCTGACTTCTCGAGAAGTCAGAGAAGAGTTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138805
FAM3D MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 3, member D
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138805.2-657s21c1
Sequence:CCGGCATGTACTCTGGAGATGTTATCTCGAGATAACATCTCCAGAGTACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138805.2-330s21c1
Sequence:CCGGCCTCATCTTTGCCATAGTCACCTCGAGGTGACTATGGCAAAGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138805.2-582s21c1
Sequence:CCGGCAATGTGGGCAGAGGCCTAAACTCGAGTTTAGGCCTCTGCCCACATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138805.2-481s1c1
Sequence:CCGGCCAGCCAACTACTTTGCGTTTCTCGAGAAACGCAAAGTAGTTGGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138805.2-543s1c1
Sequence:CCGGGTGCTTTGAAGACCGCATGATCTCGAGATCATGCGGTCTTCAAAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138805.2-357s1c1
Sequence:CCGGGATGTTTATTCGAAGCTACATCTCGAGATGTAGCTTCGAATAAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138805.2-679s1c1
Sequence:CCGGCACCTAGTGAAATTCCTTAAACTCGAGTTTAAGGAATTTCACTAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138805.2-771s1c1
Sequence:CCGGCAGGAAACTCTTCTCTGACTTCTCGAGAAGTCAGAGAAGAGTTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)