EMAIL THIS PAGE TO A FRIEND

FAM58A

family with sequence similarity 58, member A

61 Gene Product Result for
Synonyms: STAR
UniProtKB ID: Q8N1B3, Q2I380, Q330J9, Q96IU5, Q9BUU1
Gene ID:
Human(92002) Summary: Mutations in this gene have been shown to cause an X-linked dominant STAR syndrome that typically manifests syndactyly, telecanthus and anogenital and renal malformations. The protein encoded by this gene contains a cyclin-box-fold domain which suggests it may have a role in controlling nuclear cell division cycles. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2008]
Zebrafish(553650) family with sequence similarity 58, member A
cow(534796) family with sequence similarity 58, member A
domestic cat(101087461) family with sequence similarity 58, member A
dog(492239) family with sequence similarity 58, member A
domestic guinea pig(100728930) family with sequence similarity 58, member A
sheep(101111859) family with sequence similarity 58, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152274 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152274 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152274 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108741 MISSION® esiRNA esiRNA human FAM58A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152274 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146424 predicted 704
2 SASI_Hs02_00365803 predicted 937
3 SASI_Hs02_00365804 predicted 950
4 SASI_Hs02_00365805 predicted 953
5 SASI_Hs02_00365806 predicted 942
6 SASI_Hs02_00365807 predicted 703
7 SASI_Hs02_00365808 predicted 924
8 SASI_Hs02_00365809 predicted 1049
9 SASI_Hs02_00365810 predicted 1130
10 SASI_Hs02_00365811 predicted 1021
11 SASI_Hs01_00146416 predicted 342
12 SASI_Hs01_00146417 predicted 197
13 SASI_Hs01_00146418 predicted 757
14 SASI_Hs01_00146419 predicted 213
15 SASI_Hs01_00146420 predicted 324
16 SASI_Hs01_00146421 predicted 666
17 SASI_Hs01_00146422 predicted 729
18 SASI_Hs01_00146423 predicted 252
19 SASI_Hs01_00146425 predicted 471
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152274
VALIDATED
FAM58A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 58, member A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152274.2-1065s1c1
Sequence:CCGGGTTTGTCCTTTGAGAGGACTTCTCGAGAAGTCCTCTCAAAGGACAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152274.2-207s1c1
Sequence:CCGGGCACCATTTACCATAAGTTCTCTCGAGAGAACTTATGGTAAATGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152274.2-262s1c1
Sequence:CCGGCCTGATTGCCATGTCTTCAATCTCGAGATTGAAGACATGGCAATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152274.2-342s1c1
Sequence:CCGGCCAACAGGTACTTTAACCCAACTCGAGTTGGGTTAAAGTACCTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147972    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152274.2-1100s1c1
Sequence:CCGGGCATGACATCAATGAAAGGAACTCGAGTTCCTTTCATTGATGTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152274.2-1083s1c1
Sequence:CCGGCTTTGACTACAATACAGGCATCTCGAGATGCCTGTATTGTAGTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152274
VALIDATED
FAM58A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 58, member A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152274.2-1065s1c1
Sequence:CCGGGTTTGTCCTTTGAGAGGACTTCTCGAGAAGTCCTCTCAAAGGACAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152274.2-207s1c1
Sequence:CCGGGCACCATTTACCATAAGTTCTCTCGAGAGAACTTATGGTAAATGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152274.2-262s1c1
Sequence:CCGGCCTGATTGCCATGTCTTCAATCTCGAGATTGAAGACATGGCAATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152274.2-342s1c1
Sequence:CCGGCCAACAGGTACTTTAACCCAACTCGAGTTGGGTTAAAGTACCTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147972    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152274.2-1100s1c1
Sequence:CCGGGCATGACATCAATGAAAGGAACTCGAGTTCCTTTCATTGATGTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152274.2-1083s1c1
Sequence:CCGGCTTTGACTACAATACAGGCATCTCGAGATGCCTGTATTGTAGTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152274
VALIDATED
FAM58A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 58, member A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152274.2-1065s1c1
Sequence:CCGGGTTTGTCCTTTGAGAGGACTTCTCGAGAAGTCCTCTCAAAGGACAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152274.2-207s1c1
Sequence:CCGGGCACCATTTACCATAAGTTCTCTCGAGAGAACTTATGGTAAATGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152274.2-262s1c1
Sequence:CCGGCCTGATTGCCATGTCTTCAATCTCGAGATTGAAGACATGGCAATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152274.2-342s1c1
Sequence:CCGGCCAACAGGTACTTTAACCCAACTCGAGTTGGGTTAAAGTACCTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147972    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152274.2-1100s1c1
Sequence:CCGGGCATGACATCAATGAAAGGAACTCGAGTTCCTTTCATTGATGTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152274.2-1083s1c1
Sequence:CCGGCTTTGACTACAATACAGGCATCTCGAGATGCCTGTATTGTAGTCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)