EMAIL THIS PAGE TO A FRIEND

FAM63B

family with sequence similarity 63, member B

236 Gene Product Result for
UniProtKB ID: Q8NBR6, B2RTT8, Q9ULQ6
Gene ID:
Mouse(235461) family with sequence similarity 63, member B
Rat(363089) family with sequence similarity 63, member B
sheep(101103728) family with sequence similarity 63, member B
naked mole-rat(101718594) family with sequence similarity 63, member B
domestic guinea pig(100722687) family with sequence similarity 63, member B
Zebrafish(368821) family with sequence similarity 63, member B
cow(524749) family with sequence similarity 63, member B
domestic cat(101081985) family with sequence similarity 63, member B
dog(487577) family with sequence similarity 63, member B
chicken(771386) family with sequence similarity 63, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019092 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019092 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019092 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172772 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172772 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172772 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040450 Rosetta Predictions human pricing
NM_001040453 Rosetta Predictions human pricing
XM_001054973 Rosetta Predictions rat pricing
XM_343420 Rosetta Predictions rat pricing
NM_172772 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308987 predicted 962
2 SASI_Hs01_00060574 predicted 1667
3 SASI_Hs01_00060575 predicted 1374
4 SASI_Hs01_00060577 predicted 1304
5 SASI_Hs01_00060579 predicted 1402
6 SASI_Hs01_00060580 predicted 1264
7 SASI_Hs01_00060581 predicted 1131
8 SASI_Hs01_00060582 predicted 1106
9 SASI_Hs01_00060583 predicted 1548
10 SASI_Hs02_00308988 predicted 1393
11 SASI_Hs01_00060576 predicted 1262
12 SASI_Hs01_00060578 predicted 1343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308993 predicted 967
2 SASI_Hs01_00043139 predicted 1663
3 SASI_Hs01_00043140 predicted 1373
4 SASI_Hs01_00043142 predicted 1301
5 SASI_Hs01_00043144 predicted 1402
6 SASI_Hs01_00043145 predicted 1264
7 SASI_Hs01_00043146 predicted 1133
8 SASI_Hs01_00043147 predicted 1105
9 SASI_Hs01_00043148 predicted 1550
10 SASI_Hs02_00308994 predicted 1396
11 SASI_Hs01_00043141 predicted 1255
12 SASI_Hs01_00043143 predicted 1348
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054973 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277892 predicted 1144
2 SASI_Rn02_00277893 predicted 984
3 SASI_Rn02_00277894 predicted 1152
4 SASI_Rn02_00277895 predicted 973
5 SASI_Rn02_00277896 predicted 1042
6 SASI_Rn02_00277897 predicted 1019
7 SASI_Rn02_00277898 predicted 409
8 SASI_Rn02_00277899 predicted 1528
9 SASI_Rn02_00277900 predicted 1371
10 SASI_Rn02_00277901 predicted 1154
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343420 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395764 predicted 1146
2 SASI_Rn02_00395765 predicted 1282
3 SASI_Rn02_00395766 predicted 977
4 SASI_Rn02_00395767 predicted 1148
5 SASI_Rn02_00395768 predicted 1352
6 SASI_Rn02_00395769 predicted 972
7 SASI_Rn02_00395770 predicted 1040
8 SASI_Rn02_00395771 predicted 408
9 SASI_Rn02_00395772 predicted 1375
10 SASI_Rn02_00395773 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172772 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199637 predicted 950
2 SASI_Mm01_00199638 predicted 1256
3 SASI_Mm01_00199639 predicted 1114
4 SASI_Mm01_00199640 predicted 993
5 SASI_Mm01_00199641 predicted 1127
6 SASI_Mm01_00199642 predicted 991
7 SASI_Mm01_00199644 predicted 1175
8 SASI_Mm01_00199645 predicted 1131
9 SASI_Mm01_00199646 predicted 1346
10 SASI_Mm02_00344666 predicted 1159
11 SASI_Mm01_00199643 predicted 1311
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019092
FAM63B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 63, member B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143316    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019092.1-1652s1c1
Sequence:CCGGGCAAAGAAACTCCAAGAGGAACTCGAGTTCCTCTTGGAGTTTCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019092.1-964s1c1
Sequence:CCGGCCACCGATGATGGAAATCATACTCGAGTATGATTTCCATCATCGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019092.1-1211s1c1
Sequence:CCGGCAGACAATAGTGAGCTGGTTACTCGAGTAACCAGCTCACTATTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019092.1-855s1c1
Sequence:CCGGGATCCAGTGGAAGGAAGAGAACTCGAGTTCTCTTCCTTCCACTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019092.1-1169s1c1
Sequence:CCGGGCTACAACCAACTAGTGGAGACTCGAGTCTCCACTAGTTGGTTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019092.1-864s1c1
Sequence:CCGGGAAGGAAGAGAACACACCCATCTCGAGATGGGTGTGTTCTCTTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019092.1-643s1c1
Sequence:CCGGGAGTCGTTCTCTAACCTGCATCTCGAGATGCAGGTTAGAGAACGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019092.1-1020s1c1
Sequence:CCGGCATGCTTGATGCAAAGCCAAACTCGAGTTTGGCTTTGCATCAAGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019092.1-1685s1c1
Sequence:CCGGGCTTCTCAATACTATCAGGAACTCGAGTTCCTGATAGTATTGAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019092.1-1013s1c1
Sequence:CCGGGAGATTACATGCTTGATGCAACTCGAGTTGCATCAAGCATGTAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019092
FAM63B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 63, member B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143316    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019092.1-1652s1c1
Sequence:CCGGGCAAAGAAACTCCAAGAGGAACTCGAGTTCCTCTTGGAGTTTCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019092.1-964s1c1
Sequence:CCGGCCACCGATGATGGAAATCATACTCGAGTATGATTTCCATCATCGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019092.1-1211s1c1
Sequence:CCGGCAGACAATAGTGAGCTGGTTACTCGAGTAACCAGCTCACTATTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019092.1-855s1c1
Sequence:CCGGGATCCAGTGGAAGGAAGAGAACTCGAGTTCTCTTCCTTCCACTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019092.1-1169s1c1
Sequence:CCGGGCTACAACCAACTAGTGGAGACTCGAGTCTCCACTAGTTGGTTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019092.1-864s1c1
Sequence:CCGGGAAGGAAGAGAACACACCCATCTCGAGATGGGTGTGTTCTCTTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019092.1-643s1c1
Sequence:CCGGGAGTCGTTCTCTAACCTGCATCTCGAGATGCAGGTTAGAGAACGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019092.1-1020s1c1
Sequence:CCGGCATGCTTGATGCAAAGCCAAACTCGAGTTTGGCTTTGCATCAAGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019092.1-1685s1c1
Sequence:CCGGGCTTCTCAATACTATCAGGAACTCGAGTTCCTGATAGTATTGAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019092.1-1013s1c1
Sequence:CCGGGAGATTACATGCTTGATGCAACTCGAGTTGCATCAAGCATGTAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019092
FAM63B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 63, member B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143316    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019092.1-1652s1c1
Sequence:CCGGGCAAAGAAACTCCAAGAGGAACTCGAGTTCCTCTTGGAGTTTCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019092.1-964s1c1
Sequence:CCGGCCACCGATGATGGAAATCATACTCGAGTATGATTTCCATCATCGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019092.1-1211s1c1
Sequence:CCGGCAGACAATAGTGAGCTGGTTACTCGAGTAACCAGCTCACTATTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019092.1-855s1c1
Sequence:CCGGGATCCAGTGGAAGGAAGAGAACTCGAGTTCTCTTCCTTCCACTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019092.1-1169s1c1
Sequence:CCGGGCTACAACCAACTAGTGGAGACTCGAGTCTCCACTAGTTGGTTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019092.1-864s1c1
Sequence:CCGGGAAGGAAGAGAACACACCCATCTCGAGATGGGTGTGTTCTCTTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019092.1-643s1c1
Sequence:CCGGGAGTCGTTCTCTAACCTGCATCTCGAGATGCAGGTTAGAGAACGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019092.1-1020s1c1
Sequence:CCGGCATGCTTGATGCAAAGCCAAACTCGAGTTTGGCTTTGCATCAAGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019092.1-1685s1c1
Sequence:CCGGGCTTCTCAATACTATCAGGAACTCGAGTTCCTGATAGTATTGAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019092.1-1013s1c1
Sequence:CCGGGAGATTACATGCTTGATGCAACTCGAGTTGCATCAAGCATGTAATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172772
VALIDATED
FAM63B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 63, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172772.2-5312s21c1
Sequence:CCGGGCCACTACTACAGGCATATATCTCGAGATATATGCCTGTAGTAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172772.2-1383s21c1
Sequence:CCGGTGTGTGTTCTTTCGGAATAATCTCGAGATTATTCCGAAAGAACACACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172772.2-781s21c1
Sequence:CCGGAGTCGGTGTATCACATCAAATCTCGAGATTTGATGTGATACACCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172772.2-947s21c1
Sequence:CCGGGATGGAATATTTAGGTGATTACTCGAGTAATCACCTAAATATTCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172772.2-995s21c1
Sequence:CCGGATCAGAAATTCAACGTGTAAACTCGAGTTTACACGTTGAATTTCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172772
VALIDATED
FAM63B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 63, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172772.2-5312s21c1
Sequence:CCGGGCCACTACTACAGGCATATATCTCGAGATATATGCCTGTAGTAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172772.2-1383s21c1
Sequence:CCGGTGTGTGTTCTTTCGGAATAATCTCGAGATTATTCCGAAAGAACACACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172772.2-781s21c1
Sequence:CCGGAGTCGGTGTATCACATCAAATCTCGAGATTTGATGTGATACACCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172772.2-947s21c1
Sequence:CCGGGATGGAATATTTAGGTGATTACTCGAGTAATCACCTAAATATTCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172772.2-995s21c1
Sequence:CCGGATCAGAAATTCAACGTGTAAACTCGAGTTTACACGTTGAATTTCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172772
VALIDATED
FAM63B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 63, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172772.2-5312s21c1
Sequence:CCGGGCCACTACTACAGGCATATATCTCGAGATATATGCCTGTAGTAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172772.2-1383s21c1
Sequence:CCGGTGTGTGTTCTTTCGGAATAATCTCGAGATTATTCCGAAAGAACACACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172772.2-781s21c1
Sequence:CCGGAGTCGGTGTATCACATCAAATCTCGAGATTTGATGTGATACACCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172772.2-947s21c1
Sequence:CCGGGATGGAATATTTAGGTGATTACTCGAGTAATCACCTAAATATTCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172772.2-995s21c1
Sequence:CCGGATCAGAAATTCAACGTGTAAACTCGAGTTTACACGTTGAATTTCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)