EMAIL THIS PAGE TO A FRIEND

FAM78A

family with sequence similarity 78, member A

67 Gene Product Result for
Synonyms: C9orf59
UniProtKB ID: Q5JUQ0, Q86VQ9, Q9H7P4
Gene ID:
Mouse(241303) family with sequence similarity 78, member A
Rat(499776) family with sequence similarity 78, member A
chicken(771980) family with sequence similarity 78, member A
dog(480692) family with sequence similarity 78, member A
cow(506709) family with sequence similarity 78, member A
domestic cat(101087884) family with sequence similarity 78, member A
sheep(101121926) family with sequence similarity 78, member A
naked mole-rat(101721476) family with sequence similarity 78, member A
domestic guinea pig(100735654) family with sequence similarity 78, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033387 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033387 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033387 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175511 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175511 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175511 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033387 Rosetta Predictions human pricing
XM_001079857 Rosetta Predictions rat pricing
XM_575110 Rosetta Predictions rat pricing
NM_175511 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032769 predicted 794
2 SASI_Hs01_00032770 predicted 1265
3 SASI_Hs01_00032771 predicted 615
4 SASI_Hs01_00032772 predicted 1446
5 SASI_Hs01_00032773 predicted 1663
6 SASI_Hs01_00032774 predicted 1652
7 SASI_Hs01_00032775 predicted 973
8 SASI_Hs01_00032777 predicted 1251
9 SASI_Hs01_00032778 predicted 1243
10 SASI_Hs02_00361242 predicted 1206
11 SASI_Hs01_00032776 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079857 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365758 predicted 1511
2 SASI_Rn02_00365759 predicted 1466
3 SASI_Rn02_00365760 predicted 1463
4 SASI_Rn02_00365761 predicted 1502
5 SASI_Rn02_00365762 predicted 1126
6 SASI_Rn02_00365763 predicted 1467
7 SASI_Rn02_00365764 predicted 1501
8 SASI_Rn02_00365765 predicted 1509
9 SASI_Rn02_00365766 predicted 1314
10 SASI_Rn02_00365767 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575110 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403075 predicted 1515
2 SASI_Rn02_00403076 predicted 1471
3 SASI_Rn02_00403077 predicted 1738
4 SASI_Rn02_00403078 predicted 1748
5 SASI_Rn02_00403079 predicted 1834
6 SASI_Rn02_00403080 predicted 1472
7 SASI_Rn02_00403081 predicted 1500
8 SASI_Rn02_00403082 predicted 1125
9 SASI_Rn02_00403083 predicted 1466
10 SASI_Rn02_00403084 predicted 1502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175511 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346431 predicted 1245
2 SASI_Mm01_00140808 predicted 1762
3 SASI_Mm01_00140809 predicted 1672
4 SASI_Mm01_00140810 predicted 2031
5 SASI_Mm01_00140811 predicted 2123
6 SASI_Mm02_00346432 predicted 1397
7 SASI_Mm01_00140812 predicted 1427
8 SASI_Mm01_00140814 predicted 1233
9 SASI_Mm01_00140815 predicted 1445
10 SASI_Mm01_00140816 predicted 1234
11 SASI_Mm01_00140813 predicted 1672
12 SASI_Mm01_00140817 predicted 880
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033387
FAM78A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 78, member A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033387.2-793s1c1
Sequence:CCGGCTCCAAGTTCATCATCAGCATCTCGAGATGCTGATGATGAACTTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033387.2-628s1c1
Sequence:CCGGCATGGAGTTCTACAACCAGTACTCGAGTACTGGTTGTAGAACTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033387.2-446s1c1
Sequence:CCGGGAAGGGATCACGGTGATTGATCTCGAGATCAATCACCGTGATCCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033387.2-784s1c1
Sequence:CCGGCAAGAGGGACTCCAAGTTCATCTCGAGATGAACTTGGAGTCCCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033387.2-451s1c1
Sequence:CCGGGATCACGGTGATTGATGTGAACTCGAGTTCACATCAATCACCGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033387.3-1598s21c1
Sequence:CCGGGATCCACACTGCTGCCGATTTCTCGAGAAATCGGCAGCAGTGTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033387.3-1209s21c1
Sequence:CCGACTAGGTTAGACTCACAAATAACTCGAGTTATTTGTGAGTCTAACCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033387.3-393s21c1
Sequence:CCGGTGTATGCCATGGGCTGTATTCCTCGAGGAATACAGCCCATGGCATACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033387
FAM78A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 78, member A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033387.2-793s1c1
Sequence:CCGGCTCCAAGTTCATCATCAGCATCTCGAGATGCTGATGATGAACTTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033387.2-628s1c1
Sequence:CCGGCATGGAGTTCTACAACCAGTACTCGAGTACTGGTTGTAGAACTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033387.2-446s1c1
Sequence:CCGGGAAGGGATCACGGTGATTGATCTCGAGATCAATCACCGTGATCCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033387.2-784s1c1
Sequence:CCGGCAAGAGGGACTCCAAGTTCATCTCGAGATGAACTTGGAGTCCCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033387.2-451s1c1
Sequence:CCGGGATCACGGTGATTGATGTGAACTCGAGTTCACATCAATCACCGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033387.3-1598s21c1
Sequence:CCGGGATCCACACTGCTGCCGATTTCTCGAGAAATCGGCAGCAGTGTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033387.3-1209s21c1
Sequence:CCGACTAGGTTAGACTCACAAATAACTCGAGTTATTTGTGAGTCTAACCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033387.3-393s21c1
Sequence:CCGGTGTATGCCATGGGCTGTATTCCTCGAGGAATACAGCCCATGGCATACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033387
FAM78A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 78, member A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033387.2-793s1c1
Sequence:CCGGCTCCAAGTTCATCATCAGCATCTCGAGATGCTGATGATGAACTTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033387.2-628s1c1
Sequence:CCGGCATGGAGTTCTACAACCAGTACTCGAGTACTGGTTGTAGAACTCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033387.2-446s1c1
Sequence:CCGGGAAGGGATCACGGTGATTGATCTCGAGATCAATCACCGTGATCCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033387.2-784s1c1
Sequence:CCGGCAAGAGGGACTCCAAGTTCATCTCGAGATGAACTTGGAGTCCCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033387.2-451s1c1
Sequence:CCGGGATCACGGTGATTGATGTGAACTCGAGTTCACATCAATCACCGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033387.3-1598s21c1
Sequence:CCGGGATCCACACTGCTGCCGATTTCTCGAGAAATCGGCAGCAGTGTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033387.3-1209s21c1
Sequence:CCGACTAGGTTAGACTCACAAATAACTCGAGTTATTTGTGAGTCTAACCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033387.3-393s21c1
Sequence:CCGGTGTATGCCATGGGCTGTATTCCTCGAGGAATACAGCCCATGGCATACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175511
FAM78A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 78, member A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175511.2-1526s1c1
Sequence:CCGGCCTTAGCAAGAATGAGCCCATCTCGAGATGGGCTCATTCTTGCTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175511.2-906s1c1
Sequence:CCGGGAAGGGATTACCGTGATTGATCTCGAGATCAATCACGGTAATCCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175511.2-1388s1c1
Sequence:CCGGCAACACCTCCACCAATGATATCTCGAGATATCATTGGTGGAGGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175511.4-1440s21c1
Sequence:CCGGAGCTGAGCATCGAGGTGAATCCTCGAGGATTCACCTCGATGCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175511.4-3041s21c1
Sequence:CCGGCTGGATTCGAACCAGTAATAACTCGAGTTATTACTGGTTCGAATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175511.4-1191s21c1
Sequence:CCGGACTATCCCTGGTACGGCAATACTCGAGTATTGCCGTACCAGGGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175511.4-1387s21c1
Sequence:CCGGCAACACCTCCACCAATGATATCTCGAGATATCATTGGTGGAGGTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175511.4-903s21c1
Sequence:CCGGGGGAAGGGATTACCGTGATTGCTCGAGCAATCACGGTAATCCCTTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175511
FAM78A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 78, member A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175511.2-1526s1c1
Sequence:CCGGCCTTAGCAAGAATGAGCCCATCTCGAGATGGGCTCATTCTTGCTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175511.2-906s1c1
Sequence:CCGGGAAGGGATTACCGTGATTGATCTCGAGATCAATCACGGTAATCCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175511.2-1388s1c1
Sequence:CCGGCAACACCTCCACCAATGATATCTCGAGATATCATTGGTGGAGGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175511.4-1440s21c1
Sequence:CCGGAGCTGAGCATCGAGGTGAATCCTCGAGGATTCACCTCGATGCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175511.4-3041s21c1
Sequence:CCGGCTGGATTCGAACCAGTAATAACTCGAGTTATTACTGGTTCGAATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175511.4-1191s21c1
Sequence:CCGGACTATCCCTGGTACGGCAATACTCGAGTATTGCCGTACCAGGGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175511.4-1387s21c1
Sequence:CCGGCAACACCTCCACCAATGATATCTCGAGATATCATTGGTGGAGGTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175511.4-903s21c1
Sequence:CCGGGGGAAGGGATTACCGTGATTGCTCGAGCAATCACGGTAATCCCTTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175511
FAM78A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 78, member A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175511.2-1526s1c1
Sequence:CCGGCCTTAGCAAGAATGAGCCCATCTCGAGATGGGCTCATTCTTGCTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175511.2-906s1c1
Sequence:CCGGGAAGGGATTACCGTGATTGATCTCGAGATCAATCACGGTAATCCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175511.2-1388s1c1
Sequence:CCGGCAACACCTCCACCAATGATATCTCGAGATATCATTGGTGGAGGTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175511.4-1440s21c1
Sequence:CCGGAGCTGAGCATCGAGGTGAATCCTCGAGGATTCACCTCGATGCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175511.4-3041s21c1
Sequence:CCGGCTGGATTCGAACCAGTAATAACTCGAGTTATTACTGGTTCGAATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175511.4-1191s21c1
Sequence:CCGGACTATCCCTGGTACGGCAATACTCGAGTATTGCCGTACCAGGGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175511.4-1387s21c1
Sequence:CCGGCAACACCTCCACCAATGATATCTCGAGATATCATTGGTGGAGGTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175511.4-903s21c1
Sequence:CCGGGGGAAGGGATTACCGTGATTGCTCGAGCAATCACGGTAATCCCTTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)