EMAIL THIS PAGE TO A FRIEND

FAM84B

family with sequence similarity 84, member B

210 Gene Product Result for
Synonyms: BCMP101 NSE2
UniProtKB ID: Q96KN1
Gene ID:
Mouse(399603) family with sequence similarity 84, member B
Rat(315019) family with sequence similarity 84, member B
domestic guinea pig(100731546) family with sequence similarity 84, member B
naked mole-rat(101705713) family with sequence similarity 84, member B
sheep(101102154) family with sequence similarity 84, member B
Zebrafish(767732) family with sequence similarity 84, member B
chicken(770776) family with sequence similarity 84, member B
cow(540325) family with sequence similarity 84, member B
domestic cat(101091254) family with sequence similarity 84, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001162926 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001162926 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001162926 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_174911 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174911 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174911 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207269 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207269 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207269 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU191891 MISSION® esiRNA esiRNA targeting mouse Fam84b mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174911 Rosetta Predictions human pricing
XM_001065527 Rosetta Predictions rat pricing
XM_001065586 Rosetta Predictions rat pricing
XM_235349 Rosetta Predictions rat pricing
NM_207269 Rosetta Predictions mouse pricing
XR_035220 Rosetta Predictions mouse pricing
XR_035243 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122428 predicted 639
2 SASI_Hs01_00122429 predicted 730
3 SASI_Hs01_00122430 predicted 993
4 SASI_Hs01_00122431 predicted 1489
5 SASI_Hs01_00122432 predicted 1485
6 SASI_Hs01_00122434 predicted 529
7 SASI_Hs01_00122435 predicted 1698
8 SASI_Hs01_00122436 predicted 1515
9 SASI_Hs01_00122437 predicted 1632
10 SASI_Hs02_00368819 predicted 284
11 SASI_Hs01_00122433 predicted 1518
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065527 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314474 predicted 1439
2 SASI_Rn02_00314475 predicted 554
3 SASI_Rn02_00314476 predicted 1455
4 SASI_Rn02_00314477 predicted 554
5 SASI_Rn02_00314478 predicted 1299
6 SASI_Rn02_00314479 predicted 822
7 SASI_Rn02_00314480 predicted 480
8 SASI_Rn02_00314481 predicted 1564
9 SASI_Rn02_00314482 predicted 507
10 SASI_Rn02_00314483 predicted 1446
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065586 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314747 predicted 1774
2 SASI_Rn02_00314748 predicted 885
3 SASI_Rn02_00314749 predicted 1786
4 SASI_Rn02_00314750 predicted 890
5 SASI_Rn02_00314751 predicted 1621
6 SASI_Rn02_00314752 predicted 1153
7 SASI_Rn02_00314753 predicted 810
8 SASI_Rn02_00314754 predicted 1890
9 SASI_Rn02_00314755 predicted 833
10 SASI_Rn02_00314756 predicted 1766
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235349 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389187 predicted 1738
2 SASI_Rn02_00389188 predicted 849
3 SASI_Rn02_00389189 predicted 1752
4 SASI_Rn02_00389190 predicted 856
5 SASI_Rn02_00389191 predicted 1597
6 SASI_Rn02_00389192 predicted 1119
7 SASI_Rn02_00389193 predicted 774
8 SASI_Rn02_00389194 predicted 1862
9 SASI_Rn02_00389195 predicted 798
10 SASI_Rn02_00389196 predicted 1736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207269 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176329 predicted 643
2 SASI_Mm01_00176330 predicted 309
3 SASI_Mm01_00176331 predicted 625
4 SASI_Mm01_00176332 predicted 764
5 SASI_Mm01_00176333 predicted 664
6 SASI_Mm01_00176334 predicted 518
7 SASI_Mm01_00176335 predicted 826
8 SASI_Mm01_00176336 predicted 356
9 SASI_Mm01_00176337 predicted 710
10 SASI_Mm01_00176338 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035220 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00480643 predicted 4461
2 SASI_Mm02_00480644 predicted 5190
3 SASI_Mm02_00480645 predicted 1787
4 SASI_Mm02_00480646 predicted 4298
5 SASI_Mm02_00480647 predicted 3419
6 SASI_Mm02_00480648 predicted 3569
7 SASI_Mm02_00480649 predicted 5214
8 SASI_Mm02_00480650 predicted 3399
9 SASI_Mm02_00480651 predicted 5179
10 SASI_Mm02_00480652 predicted 4162
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035243 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00480868 predicted 5633
2 SASI_Mm02_00480869 predicted 6362
3 SASI_Mm02_00480870 predicted 2953
4 SASI_Mm02_00480871 predicted 5467
5 SASI_Mm02_00480872 predicted 4589
6 SASI_Mm02_00480873 predicted 4743
7 SASI_Mm02_00480874 predicted 4574
8 SASI_Mm02_00480875 predicted 6346
9 SASI_Mm02_00480876 predicted 5330
10 SASI_Mm02_00480877 predicted 4430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001162926
FAM84B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 84, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162926.1-1062s21c1
Sequence:CCGGGGCTGTCTACGTGGGCAATTTCTCGAGAAATTGCCCACGTAGACAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162926.1-923s21c1
Sequence:CCGGATCGTGATGAGTGCATCTATCCTCGAGGATAGATGCACTCATCACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162926.1-1895s21c1
Sequence:CCGGTCAGATCTGGGACCAAATTTACTCGAGTAAATTTGGTCCCAGATCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162926.1-753s21c1
Sequence:CCGGCCGCATCGGAGTCTCTTATATCTCGAGATATAAGAGACTCCGATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162926.1-1033s21c1
Sequence:CCGGTTTGTATCGCAGGCTCAATACCTCGAGGTATTGAGCCTGCGATACAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001162926
FAM84B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 84, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162926.1-1062s21c1
Sequence:CCGGGGCTGTCTACGTGGGCAATTTCTCGAGAAATTGCCCACGTAGACAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162926.1-923s21c1
Sequence:CCGGATCGTGATGAGTGCATCTATCCTCGAGGATAGATGCACTCATCACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162926.1-1895s21c1
Sequence:CCGGTCAGATCTGGGACCAAATTTACTCGAGTAAATTTGGTCCCAGATCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162926.1-753s21c1
Sequence:CCGGCCGCATCGGAGTCTCTTATATCTCGAGATATAAGAGACTCCGATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162926.1-1033s21c1
Sequence:CCGGTTTGTATCGCAGGCTCAATACCTCGAGGTATTGAGCCTGCGATACAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001162926
FAM84B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 84, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162926.1-1062s21c1
Sequence:CCGGGGCTGTCTACGTGGGCAATTTCTCGAGAAATTGCCCACGTAGACAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162926.1-923s21c1
Sequence:CCGGATCGTGATGAGTGCATCTATCCTCGAGGATAGATGCACTCATCACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162926.1-1895s21c1
Sequence:CCGGTCAGATCTGGGACCAAATTTACTCGAGTAAATTTGGTCCCAGATCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162926.1-753s21c1
Sequence:CCGGCCGCATCGGAGTCTCTTATATCTCGAGATATAAGAGACTCCGATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162926.1-1033s21c1
Sequence:CCGGTTTGTATCGCAGGCTCAATACCTCGAGGTATTGAGCCTGCGATACAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174911
VALIDATED
FAM84B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 84, member B
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174911.3-1020s21c1
Sequence:CCGGAGTCTAGAGGACCTGATCATGCTCGAGCATGATCAGGTCCTCTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174911.3-785s21c1
Sequence:CCGGCAACGATCTGTACCGCTACAACTCGAGTTGTAGCGGTACAGATCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174911.3-1514s21c1
Sequence:CCGGTTGGTAGATCTGGGTTTATAACTCGAGTTATAAACCCAGATCTACCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174911.3-683s21c1
Sequence:CCGGGGCCGTATATGTGGGTAACTTCTCGAGAAGTTACCCACATATACGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174911.3-524s21c1
Sequence:CCGGGGTGGAATGCTCCGTGTTCTACTCGAGTAGAACACGGAGCATTCCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_174911.3-1499s1c1
Sequence:CCGGCCTGGCACTTAAACCTTGGTACTCGAGTACCAAGGTTTAAGTGCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174911.3-614s1c1
Sequence:CCGGGAACCTGCTCAACAAGTGCAACTCGAGTTGCACTTGTTGAGCAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174911.3-684s1c1
Sequence:CCGGGCCGTATATGTGGGTAACTTCCTCGAGGAAGTTACCCACATATACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174911.3-725s1c1
Sequence:CCGGGCTGGAGGTGATTAACAGCTTCTCGAGAAGCTGTTAATCACCTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_174911.3-312s1c1
Sequence:CCGGCACCTAAGTTACAAGGAAGTTCTCGAGAACTTCCTTGTAACTTAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174911.3-2174s1c1
Sequence:CCGGGCCACTCCATAAAGTATCTATCTCGAGATAGATACTTTATGGAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_174911.3-4489s1c1
Sequence:CCGGCCAGACCTATAAGGAAATGTTCTCGAGAACATTTCCTTATAGGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_174911.3-785s1c1
Sequence:CCGGCAACGATCTGTACCGCTACAACTCGAGTTGTAGCGGTACAGATCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174911
VALIDATED
FAM84B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 84, member B
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174911.3-1020s21c1
Sequence:CCGGAGTCTAGAGGACCTGATCATGCTCGAGCATGATCAGGTCCTCTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174911.3-785s21c1
Sequence:CCGGCAACGATCTGTACCGCTACAACTCGAGTTGTAGCGGTACAGATCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174911.3-1514s21c1
Sequence:CCGGTTGGTAGATCTGGGTTTATAACTCGAGTTATAAACCCAGATCTACCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174911.3-683s21c1
Sequence:CCGGGGCCGTATATGTGGGTAACTTCTCGAGAAGTTACCCACATATACGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174911.3-524s21c1
Sequence:CCGGGGTGGAATGCTCCGTGTTCTACTCGAGTAGAACACGGAGCATTCCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_174911.3-1499s1c1
Sequence:CCGGCCTGGCACTTAAACCTTGGTACTCGAGTACCAAGGTTTAAGTGCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174911.3-614s1c1
Sequence:CCGGGAACCTGCTCAACAAGTGCAACTCGAGTTGCACTTGTTGAGCAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174911.3-684s1c1
Sequence:CCGGGCCGTATATGTGGGTAACTTCCTCGAGGAAGTTACCCACATATACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174911.3-725s1c1
Sequence:CCGGGCTGGAGGTGATTAACAGCTTCTCGAGAAGCTGTTAATCACCTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_174911.3-312s1c1
Sequence:CCGGCACCTAAGTTACAAGGAAGTTCTCGAGAACTTCCTTGTAACTTAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174911.3-2174s1c1
Sequence:CCGGGCCACTCCATAAAGTATCTATCTCGAGATAGATACTTTATGGAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_174911.3-4489s1c1
Sequence:CCGGCCAGACCTATAAGGAAATGTTCTCGAGAACATTTCCTTATAGGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_174911.3-785s1c1
Sequence:CCGGCAACGATCTGTACCGCTACAACTCGAGTTGTAGCGGTACAGATCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174911
VALIDATED
FAM84B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 84, member B
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174911.3-1020s21c1
Sequence:CCGGAGTCTAGAGGACCTGATCATGCTCGAGCATGATCAGGTCCTCTAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174911.3-785s21c1
Sequence:CCGGCAACGATCTGTACCGCTACAACTCGAGTTGTAGCGGTACAGATCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174911.3-1514s21c1
Sequence:CCGGTTGGTAGATCTGGGTTTATAACTCGAGTTATAAACCCAGATCTACCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174911.3-683s21c1
Sequence:CCGGGGCCGTATATGTGGGTAACTTCTCGAGAAGTTACCCACATATACGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174911.3-524s21c1
Sequence:CCGGGGTGGAATGCTCCGTGTTCTACTCGAGTAGAACACGGAGCATTCCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_174911.3-1499s1c1
Sequence:CCGGCCTGGCACTTAAACCTTGGTACTCGAGTACCAAGGTTTAAGTGCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174911.3-614s1c1
Sequence:CCGGGAACCTGCTCAACAAGTGCAACTCGAGTTGCACTTGTTGAGCAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174911.3-684s1c1
Sequence:CCGGGCCGTATATGTGGGTAACTTCCTCGAGGAAGTTACCCACATATACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174911.3-725s1c1
Sequence:CCGGGCTGGAGGTGATTAACAGCTTCTCGAGAAGCTGTTAATCACCTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_174911.3-312s1c1
Sequence:CCGGCACCTAAGTTACAAGGAAGTTCTCGAGAACTTCCTTGTAACTTAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174911.3-2174s1c1
Sequence:CCGGGCCACTCCATAAAGTATCTATCTCGAGATAGATACTTTATGGAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_174911.3-4489s1c1
Sequence:CCGGCCAGACCTATAAGGAAATGTTCTCGAGAACATTTCCTTATAGGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_174911.3-785s1c1
Sequence:CCGGCAACGATCTGTACCGCTACAACTCGAGTTGTAGCGGTACAGATCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207269
FAM84B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 84, member B
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000201210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207269.1-258s1c1
Sequence:CCGGGCCAGGGAAAGGATTCAATTACTCGAGTAATTGAATCCTTTCCCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207269.1-80s1c1
Sequence:CCGGCCCGTATTAAGTGCAGCAAATCTCGAGATTTGCTGCACTTAATACGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207269.1-90s1c1
Sequence:CCGGGTGCAGCAAATACTTTAGCAACTCGAGTTGCTAAAGTATTTGCTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207269
FAM84B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 84, member B
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000201210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207269.1-258s1c1
Sequence:CCGGGCCAGGGAAAGGATTCAATTACTCGAGTAATTGAATCCTTTCCCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207269.1-80s1c1
Sequence:CCGGCCCGTATTAAGTGCAGCAAATCTCGAGATTTGCTGCACTTAATACGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207269.1-90s1c1
Sequence:CCGGGTGCAGCAAATACTTTAGCAACTCGAGTTGCTAAAGTATTTGCTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207269
FAM84B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 84, member B
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000201210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207269.1-258s1c1
Sequence:CCGGGCCAGGGAAAGGATTCAATTACTCGAGTAATTGAATCCTTTCCCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207269.1-80s1c1
Sequence:CCGGCCCGTATTAAGTGCAGCAAATCTCGAGATTTGCTGCACTTAATACGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207269.1-90s1c1
Sequence:CCGGGTGCAGCAAATACTTTAGCAACTCGAGTTGCTAAAGTATTTGCTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)