EMAIL THIS PAGE TO A FRIEND

FAM86A

family with sequence similarity 86, member A

39 Gene Product Result for
UniProtKB ID: Q96G04, D3DUF0, Q96S85
Gene ID:
Rat(302931) family with sequence similarity 86, member A
sheep(101104798) family with sequence similarity 86, member A
naked mole-rat(101705257) family with sequence similarity 86, member A
domestic guinea pig(100722583) family with sequence similarity 86, member A
Zebrafish(450038) family with sequence similarity 86, member A
cow(531984) family with sequence similarity 86, member A
domestic cat(101091494) family with sequence similarity 86, member A
dog(610325) family with sequence similarity 86, member A
chicken(416392) family with sequence similarity 86, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201400 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_201400 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_201400 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_201400 Rosetta Predictions human pricing
NM_201598 Rosetta Predictions human pricing
NM_001106975 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201400 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372932 predicted 957
2 SASI_Hs02_00372933 predicted 972
3 SASI_Hs02_00372934 predicted 666
4 SASI_Hs02_00372935 predicted 948
5 SASI_Hs02_00372936 predicted 978
6 SASI_Hs02_00372937 predicted 93
7 SASI_Hs02_00372938 predicted 499
8 SASI_Hs02_00372939 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373115 predicted 857
2 SASI_Hs02_00373116 predicted 867
3 SASI_Hs02_00373117 predicted 558
4 SASI_Hs02_00373118 predicted 848
5 SASI_Hs02_00373119 predicted 877
6 SASI_Hs02_00373120 predicted 92
7 SASI_Hs02_00373121 predicted 396
8 SASI_Hs02_00373122 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106975 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224256 predicted 1160
2 SASI_Rn02_00224257 predicted 563
3 SASI_Rn02_00224258 predicted 380
4 SASI_Rn02_00224259 predicted 966
5 SASI_Rn02_00224260 predicted 775
6 SASI_Rn02_00224261 predicted 219
7 SASI_Rn02_00224262 predicted 590
8 SASI_Rn02_00224263 predicted 226
9 SASI_Rn02_00224264 predicted 1233
10 SASI_Rn02_00224265 predicted 884
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201400
VALIDATED
FAM86A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 86, member A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201400.2-180s21c1
Sequence:CCAGCTGAGCTGCTGCGGGATATTTCTCGAGAAATATCCCGCAGCAGCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201400.2-144s21c1
Sequence:CCGGAGAGCTTAGAAGCAAAGTTAACTCGAGTTAACTTTGCTTCTAAGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_201400.1-974s1c1
Sequence:CCGGGCAGAAACTGTTTCCCTACGACTCGAGTCGTAGGGAAACAGTTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_201400.1-1223s1c1
Sequence:CCGGGCCAGCAGTTCTGGTTCTTAACTCGAGTTAAGAACCAGAACTGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_201400.1-669s1c1
Sequence:CCGGGCAGACATCACTGCCAAGTTACTCGAGTAACTTGGCAGTGATGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_201400.1-765s1c1
Sequence:CCGGGATGTTGTCATTGCAGCAGATCTCGAGATCTGCTGCAATGACAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_201400.1-633s1c1
Sequence:CCGGCGAGGGAATGTCCTTCTCAATCTCGAGATTGAGAAGGACATTCCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201400
VALIDATED
FAM86A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 86, member A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201400.2-180s21c1
Sequence:CCAGCTGAGCTGCTGCGGGATATTTCTCGAGAAATATCCCGCAGCAGCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201400.2-144s21c1
Sequence:CCGGAGAGCTTAGAAGCAAAGTTAACTCGAGTTAACTTTGCTTCTAAGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_201400.1-974s1c1
Sequence:CCGGGCAGAAACTGTTTCCCTACGACTCGAGTCGTAGGGAAACAGTTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_201400.1-1223s1c1
Sequence:CCGGGCCAGCAGTTCTGGTTCTTAACTCGAGTTAAGAACCAGAACTGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_201400.1-669s1c1
Sequence:CCGGGCAGACATCACTGCCAAGTTACTCGAGTAACTTGGCAGTGATGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_201400.1-765s1c1
Sequence:CCGGGATGTTGTCATTGCAGCAGATCTCGAGATCTGCTGCAATGACAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_201400.1-633s1c1
Sequence:CCGGCGAGGGAATGTCCTTCTCAATCTCGAGATTGAGAAGGACATTCCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201400
VALIDATED
FAM86A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 86, member A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201400.2-180s21c1
Sequence:CCAGCTGAGCTGCTGCGGGATATTTCTCGAGAAATATCCCGCAGCAGCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201400.2-144s21c1
Sequence:CCGGAGAGCTTAGAAGCAAAGTTAACTCGAGTTAACTTTGCTTCTAAGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_201400.1-974s1c1
Sequence:CCGGGCAGAAACTGTTTCCCTACGACTCGAGTCGTAGGGAAACAGTTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_201400.1-1223s1c1
Sequence:CCGGGCCAGCAGTTCTGGTTCTTAACTCGAGTTAAGAACCAGAACTGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_201400.1-669s1c1
Sequence:CCGGGCAGACATCACTGCCAAGTTACTCGAGTAACTTGGCAGTGATGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_201400.1-765s1c1
Sequence:CCGGGATGTTGTCATTGCAGCAGATCTCGAGATCTGCTGCAATGACAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_201400.1-633s1c1
Sequence:CCGGCGAGGGAATGTCCTTCTCAATCTCGAGATTGAGAAGGACATTCCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)