EMAIL THIS PAGE TO A FRIEND

FAM98C

family with sequence similarity 98, member C

58 Gene Product Result for
UniProtKB ID: Q17RN3, A6NMW3, Q66K45
Gene ID:
Mouse(73833) family with sequence similarity 98, member C
Rat(292764) family with sequence similarity 98, member C
sheep(101110960) family with sequence similarity 98, member C
naked mole-rat(101708015) family with sequence similarity 98, member C
domestic guinea pig(100727298) family with sequence similarity 98, member C
cow(508569) family with sequence similarity 98, member C
domestic cat(101094718) family with sequence similarity 98, member C
dog(484529) family with sequence similarity 98, member C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174905 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174905 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174905 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028661 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028661 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028661 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174905 Rosetta Predictions human pricing
NM_001004219 Rosetta Predictions rat pricing
NM_028661 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368805 predicted 613
2 SASI_Hs01_00036067 predicted 935
3 SASI_Hs01_00036066 predicted 829
4 SASI_Hs01_00036070 predicted 830
5 SASI_Hs02_00368806 predicted 629
6 SASI_Hs02_00368807 predicted 919
7 SASI_Hs02_00368808 predicted 936
8 SASI_Hs01_00036074 predicted 794
9 SASI_Hs02_00368809 predicted 862
10 SASI_Hs02_00368810 predicted 785
11 SASI_Hs01_00036068 predicted 851
12 SASI_Hs01_00036069 predicted 851
13 SASI_Hs01_00036071 predicted 314
14 SASI_Hs01_00036072 predicted 913
15 SASI_Hs01_00036073 predicted 225
16 SASI_Hs01_00036075 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004219 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114707 predicted 958
2 SASI_Rn01_00114708 predicted 498
3 SASI_Rn01_00114710 predicted 831
4 SASI_Rn01_00114711 predicted 687
5 SASI_Rn01_00114712 predicted 843
6 SASI_Rn01_00114713 predicted 564
7 SASI_Rn01_00114714 predicted 650
8 SASI_Rn02_00198210 predicted 495
9 SASI_Rn01_00114715 predicted 792
10 SASI_Rn02_00198211 predicted 483
11 SASI_Rn01_00114709 predicted 567
12 SASI_Rn01_00114716 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028661 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180778 predicted 832
2 SASI_Mm01_00180779 predicted 826
3 SASI_Mm01_00180780 predicted 824
4 SASI_Mm01_00180781 predicted 793
5 SASI_Mm01_00180782 predicted 847
6 SASI_Mm01_00180783 predicted 899
7 SASI_Mm01_00180784 predicted 819
8 SASI_Mm01_00180785 predicted 902
9 SASI_Mm01_00180786 predicted 830
10 SASI_Mm01_00180787 predicted 826
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174905
VALIDATED
FAM98C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 98, member C
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174905.3-485s21c1
Sequence:CCGGGAACTGGACCTTACCCTCCAACTCGAGTTGGAGGGTAAGGTCCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174905.3-788s21c1
Sequence:CCGGAGGGCAGTGCTGATCCCAATTCTCGAGAATTGGGATCAGCACTGCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174905.3-1109s21c1
Sequence:CCGGATGCTAATGCTATCGGTAATCCTCGAGGATTACCGATAGCATTAGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174905.3-418s21c1
Sequence:CCGGTCTGCTGGATCCGAGTCCTAGCTCGAGCTAGGACTCGGATCCAGCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174905.2-813s1c1
Sequence:CCGGCCAGAATCGGACATCTCCATTCTCGAGAATGGAGATGTCCGATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174905.2-663s1c1
Sequence:CCGGCAAAGCCTCAGAGATCAGTACCTCGAGGTACTGATCTCTGAGGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174905.2-719s1c1
Sequence:CCGGCCTCACTACATCTGCTTTCCACTCGAGTGGAAAGCAGATGTAGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174905.2-724s1c1
Sequence:CCGGCTACATCTGCTTTCCACTGGACTCGAGTCCAGTGGAAAGCAGATGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174905.2-554s1c1
Sequence:CCGGGCATGCTAAGATCTCAGAGCTCTCGAGAGCTCTGAGATCTTAGCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174905.2-662s1c1
Sequence:CCGGCCAAAGCCTCAGAGATCAGTACTCGAGTACTGATCTCTGAGGCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174905.2-545s1c1
Sequence:CCGGGCAGGAGTTGCATGCTAAGATCTCGAGATCTTAGCATGCAACTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174905.2-976s1c1
Sequence:CCGGCAAGAAGAAGAAGAAGAAGTACTCGAGTACTTCTTCTTCTTCTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174905.2-551s1c1
Sequence:CCGGGTTGCATGCTAAGATCTCAGACTCGAGTCTGAGATCTTAGCATGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174905
VALIDATED
FAM98C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 98, member C
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174905.3-485s21c1
Sequence:CCGGGAACTGGACCTTACCCTCCAACTCGAGTTGGAGGGTAAGGTCCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174905.3-788s21c1
Sequence:CCGGAGGGCAGTGCTGATCCCAATTCTCGAGAATTGGGATCAGCACTGCCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174905.3-1109s21c1
Sequence:CCGGATGCTAATGCTATCGGTAATCCTCGAGGATTACCGATAGCATTAGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174905.3-418s21c1
Sequence:CCGGTCTGCTGGATCCGAGTCCTAGCTCGAGCTAGGACTCGGATCCAGCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174905.2-813s1c1
Sequence:CCGGCCAGAATCGGACATCTCCATTCTCGAGAATGGAGATGTCCGATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174905.2-663s1c1
Sequence:CCGGCAAAGCCTCAGAGATCAGTACCTCGAGGTACTGATCTCTGAGGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174905.2-719s1c1
Sequence:CCGGCCTCACTACATCTGCTTTCCACTCGAGTGGAAAGCAGATGTAGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174905.2-724s1c1
Sequence:CCGGCTACATCTGCTTTCCACTGGACTCGAGTCCAGTGGAAAGCAGATGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174905.2-554s1c1
Sequence:CCGGGCATGCTAAGATCTCAGAGCTCTCGAGAGCTCTGAGATCTTAGCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174905.2-662s1c1
Sequence:CCGGCCAAAGCCTCAGAGATCAGTACTCGAGTACTGATCTCTGAGGCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174905.2-545s1c1
Sequence:CCGGGCAGGAGTTGCATGCTAAGATCTCGAGATCTTAGCATGCAACTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174905.2-976s1c1
Sequence:CCGGCAAGAAGAAGAAGAAGAAGTACTCGAGTACTTCTTCTTCTTCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174905.2-551s1c1
Sequence:CCGGGTTGCATGCTAAGATCTCAGACTCGAGTCTGAGATCTTAGCATGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174905
VALIDATED
FAM98C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 98, member C
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174905.3-485s21c1
Sequence:CCGGGAACTGGACCTTACCCTCCAACTCGAGTTGGAGGGTAAGGTCCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174905.3-788s21c1
Sequence:CCGGAGGGCAGTGCTGATCCCAATTCTCGAGAATTGGGATCAGCACTGCCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174905.3-1109s21c1
Sequence:CCGGATGCTAATGCTATCGGTAATCCTCGAGGATTACCGATAGCATTAGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174905.3-418s21c1
Sequence:CCGGTCTGCTGGATCCGAGTCCTAGCTCGAGCTAGGACTCGGATCCAGCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174905.2-813s1c1
Sequence:CCGGCCAGAATCGGACATCTCCATTCTCGAGAATGGAGATGTCCGATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174905.2-663s1c1
Sequence:CCGGCAAAGCCTCAGAGATCAGTACCTCGAGGTACTGATCTCTGAGGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174905.2-719s1c1
Sequence:CCGGCCTCACTACATCTGCTTTCCACTCGAGTGGAAAGCAGATGTAGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174905.2-724s1c1
Sequence:CCGGCTACATCTGCTTTCCACTGGACTCGAGTCCAGTGGAAAGCAGATGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174905.2-554s1c1
Sequence:CCGGGCATGCTAAGATCTCAGAGCTCTCGAGAGCTCTGAGATCTTAGCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174905.2-662s1c1
Sequence:CCGGCCAAAGCCTCAGAGATCAGTACTCGAGTACTGATCTCTGAGGCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174905.2-545s1c1
Sequence:CCGGGCAGGAGTTGCATGCTAAGATCTCGAGATCTTAGCATGCAACTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174905.2-976s1c1
Sequence:CCGGCAAGAAGAAGAAGAAGAAGTACTCGAGTACTTCTTCTTCTTCTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_174905.2-551s1c1
Sequence:CCGGGTTGCATGCTAAGATCTCAGACTCGAGTCTGAGATCTTAGCATGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028661
FAM98C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 98, member C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028661.1-844s1c1
Sequence:CCGGGCAATCAACAAGGTGCTTATGCTCGAGCATAAGCACCTTGTTGATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028661.1-849s1c1
Sequence:CCGGCAACAAGGTGCTTATGGGTGACTCGAGTCACCCATAAGCACCTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028661.1-990s1c1
Sequence:CCGGGAAGAAGTGAAGGGCCTTTGACTCGAGTCAAAGGCCCTTCACTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028661.1-834s1c1
Sequence:CCGGGACCAGTTGTGCAATCAACAACTCGAGTTGTTGATTGCACAACTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028661.1-837s1c1
Sequence:CCGGCAGTTGTGCAATCAACAAGGTCTCGAGACCTTGTTGATTGCACAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028661
FAM98C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 98, member C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028661.1-844s1c1
Sequence:CCGGGCAATCAACAAGGTGCTTATGCTCGAGCATAAGCACCTTGTTGATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028661.1-849s1c1
Sequence:CCGGCAACAAGGTGCTTATGGGTGACTCGAGTCACCCATAAGCACCTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028661.1-990s1c1
Sequence:CCGGGAAGAAGTGAAGGGCCTTTGACTCGAGTCAAAGGCCCTTCACTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028661.1-834s1c1
Sequence:CCGGGACCAGTTGTGCAATCAACAACTCGAGTTGTTGATTGCACAACTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028661.1-837s1c1
Sequence:CCGGCAGTTGTGCAATCAACAAGGTCTCGAGACCTTGTTGATTGCACAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028661
FAM98C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 98, member C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028661.1-844s1c1
Sequence:CCGGGCAATCAACAAGGTGCTTATGCTCGAGCATAAGCACCTTGTTGATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028661.1-849s1c1
Sequence:CCGGCAACAAGGTGCTTATGGGTGACTCGAGTCACCCATAAGCACCTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028661.1-990s1c1
Sequence:CCGGGAAGAAGTGAAGGGCCTTTGACTCGAGTCAAAGGCCCTTCACTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028661.1-834s1c1
Sequence:CCGGGACCAGTTGTGCAATCAACAACTCGAGTTGTTGATTGCACAACTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028661.1-837s1c1
Sequence:CCGGCAGTTGTGCAATCAACAAGGTCTCGAGACCTTGTTGATTGCACAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)